ORK04765

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04765

Order Kazusa clone(s) from :

Accession No	AB209167
Product ID	ORK04765
Clone name	ah00678
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DGKI
cDNA sequence	DNA sequence (5148 bp) Predicted protein sequence (871 aa)
Description	Diacylglycerol kinase iota (EC 2.7.1.107) (Diglyceride kinase iota) (DGK-iota) (DAG kinase iota).

Features of the cloned cDNA sequence

Description

Length: 5148 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2403 bp
Genome contig ID	gi89161213r_136624103
PolyA signal sequence (None)	+--------+--------+----*----+---- AAGATTCCTGATGCATTTGGAAATTTTTTCAAACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAGGCATTAGAGTCCTGTGTTATTCATGGAGACCAATATT

Features of the protein sequence

Description

Length: 871 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92404	100.0	diacylglycerol ...	Homo sapiens
AAF43006	94.3	diacylglycerol ...	Homo sapiens
O75912	94.3	Diacylglycerol ...	Homo sapiens
XP_001147695	94.2	similar to diac...	Pan troglodytes
XP_001107030	94.1	diacylglycerol ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001206	203	309	PD005043	Diacylglycerol kinase
BlastProDom	IPR000756	497	544	PD002939	Diacylglycerol kinase accessory region
FPrintScan	IPR002110	801	813	PR01415	Ankyrin
FPrintScan	IPR002110	813	825	PR01415	Ankyrin
HMMPfam	IPR002219	88	147	PF00130	Protein kinase C
	IPR001206	213	337	PF00781	Diacylglycerol kinase
	IPR000756	363	520	PF00609	Diacylglycerol kinase accessory region
	IPR002110	764	790	PF00023	Ankyrin
	IPR002110	800	832	PF00023	Ankyrin
HMMSmart	IPR002219	15	69	SM00109	Protein kinase C
	IPR002219	88	146	SM00109	Protein kinase C
	IPR001206	213	337	SM00046	Diacylglycerol kinase
	IPR000756	363	520	SM00045	Diacylglycerol kinase accessory region
	IPR002110	764	794	SM00248	Ankyrin
	IPR002110	800	829	SM00248	Ankyrin
ProfileScan	IPR002110	764	788	PS50088	Ankyrin
	IPR002110	764	853	PS50297	Ankyrin
	IPR002110	800	832	PS50088	Ankyrin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp