Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07449
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208834
Product ID ORK07449
Clone name ah00748
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF236
cDNA sequence DNA sequence (6227 bp)
Predicted protein sequence (1387 aa)
Description Zinc finger protein 236.
Features of the cloned cDNA sequence

Length: 6227 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2063 bp
Genome contig ID gi51511735f_72635956
PolyA signal sequence
(AAGAAA,-19)		 
+----*----+----*----+----*----+----
ATTTTGGTTAAAGAAAAAGAAAATATCAATAATTC
Flanking genome sequence
(175394 - 175443)		 
----+----*----+----*----+----*----+----*----+----*
AATTTTGTGTCTTTTCTCAATTTATTAGCAAACACAAGACATTTTATGTA

Features of the protein sequence

Length: 1387 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92071 0 100.0 Zinc finger pro...
 Homo sapiens
EAW66587 0 100.0 hCG21098, isofo...
 Homo sapiens
NP_031371 0 99.9 zinc finger pro...
 Homo sapiens
Q9UL36 0 99.9 Zinc finger pro...
 Homo sapiens
XP_001138862 0 99.7 zinc finger pro...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 199 222 PD000003 Zinc finger
IPR007087 509 532 PD000003 Zinc finger
IPR007087 737 760 PD000003 Zinc finger
HMMPfam IPR007087 24 46 PF00096 Zinc finger
IPR007087 52 74 PF00096 Zinc finger
IPR007087 80 102 PF00096 Zinc finger
IPR007087 108 130 PF00096 Zinc finger
IPR007087 199 221 PF00096 Zinc finger
IPR007087 227 249 PF00096 Zinc finger
IPR007087 255 277 PF00096 Zinc finger
IPR007087 283 305 PF00096 Zinc finger
IPR007087 509 531 PF00096 Zinc finger
IPR007087 537 559 PF00096 Zinc finger
IPR007087 565 587 PF00096 Zinc finger
IPR007087 593 615 PF00096 Zinc finger
IPR007087 709 731 PF00096 Zinc finger
IPR007087 737 759 PF00096 Zinc finger
IPR007087 765 787 PF00096 Zinc finger
IPR007087 793 815 PF00096 Zinc finger
IPR007087 1199 1222 PF00096 Zinc finger
IPR007087 1228 1250 PF00096 Zinc finger
IPR007087 1264 1286 PF00096 Zinc finger
IPR007087 1292 1314 PF00096 Zinc finger
IPR007087 1320 1343 PF00096 Zinc finger
HMMSmart IPR015880 24 46 SM00355 Zinc finger
IPR015880 52 74 SM00355 Zinc finger
IPR015880 80 102 SM00355 Zinc finger
IPR015880 108 130 SM00355 Zinc finger
IPR015880 199 221 SM00355 Zinc finger
IPR015880 227 249 SM00355 Zinc finger
IPR015880 255 277 SM00355 Zinc finger
IPR015880 283 305 SM00355 Zinc finger
IPR015880 509 531 SM00355 Zinc finger
IPR015880 537 559 SM00355 Zinc finger
IPR015880 565 587 SM00355 Zinc finger
IPR015880 593 615 SM00355 Zinc finger
IPR015880 709 731 SM00355 Zinc finger
IPR015880 737 759 SM00355 Zinc finger
IPR015880 765 787 SM00355 Zinc finger
IPR015880 793 815 SM00355 Zinc finger
IPR015880 1199 1222 SM00355 Zinc finger
IPR015880 1228 1250 SM00355 Zinc finger
IPR015880 1264 1286 SM00355 Zinc finger
IPR015880 1292 1314 SM00355 Zinc finger
IPR015880 1320 1343 SM00355 Zinc finger
ProfileScan IPR007087 24 51 PS50157 Zinc finger
IPR007087 52 79 PS50157 Zinc finger
IPR007087 80 107 PS50157 Zinc finger
IPR007087 108 138 PS50157 Zinc finger
IPR007087 199 226 PS50157 Zinc finger
IPR007087 227 254 PS50157 Zinc finger
IPR007087 255 282 PS50157 Zinc finger
IPR007087 283 310 PS50157 Zinc finger
IPR007087 509 536 PS50157 Zinc finger
IPR007087 537 564 PS50157 Zinc finger
IPR007087 565 592 PS50157 Zinc finger
IPR007087 593 615 PS50157 Zinc finger
IPR007087 709 736 PS50157 Zinc finger
IPR007087 737 764 PS50157 Zinc finger
IPR007087 765 792 PS50157 Zinc finger
IPR007087 793 820 PS50157 Zinc finger
IPR007087 1199 1227 PS50157 Zinc finger
IPR007087 1228 1255 PS50157 Zinc finger
IPR007087 1264 1291 PS50157 Zinc finger
IPR007087 1292 1319 PS50157 Zinc finger
IPR007087 1320 1344 PS50157 Zinc finger
ScanRegExp IPR007087 26 48 PS00028 Zinc finger
IPR007087 54 74 PS00028 Zinc finger
IPR007087 82 102 PS00028 Zinc finger
IPR007087 110 130 PS00028 Zinc finger
IPR007087 201 221 PS00028 Zinc finger
IPR007087 229 249 PS00028 Zinc finger
IPR007087 257 277 PS00028 Zinc finger
IPR007087 285 305 PS00028 Zinc finger
IPR007087 511 531 PS00028 Zinc finger
IPR007087 539 559 PS00028 Zinc finger
IPR007087 567 587 PS00028 Zinc finger
IPR007087 595 615 PS00028 Zinc finger
IPR007087 710 731 PS00028 Zinc finger
IPR007087 739 759 PS00028 Zinc finger
IPR007087 767 787 PS00028 Zinc finger
IPR007087 795 815 PS00028 Zinc finger
IPR007087 1201 1222 PS00028 Zinc finger
IPR007087 1230 1250 PS00028 Zinc finger
IPR007087 1266 1286 PS00028 Zinc finger
IPR007087 1294 1314 PS00028 Zinc finger
IPR007087 1322 1343 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp