ORK07271

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07271

Order Kazusa clone(s) from :

Accession No	AB209468
Product ID	ORK07271
Clone name	ah04629
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	UBQLN1
cDNA sequence	DNA sequence (6054 bp) Predicted protein sequence (325 aa)
Description	Ubiquilin-1 (Protein linking IAP with cytoskeleton 1) (PLIC-1) (hPLIC- 1).

Features of the cloned cDNA sequence

Description

Length: 6054 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	5076 bp
Genome contig ID	gi89161216r_85364706
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATTAATCATAAAATAACAATAAATCTCTAGCTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACACTTGATTTGTCTTGCCTCTTTTGTAGAAAGAAAAAAAGTCTTTAACT

Features of the protein sequence

Description

Length: 325 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92705	4.4e-106	100.0	ubiquilin 1 iso...	Homo sapiens
BAB20436	2.9e-105	99.3	DA41 [Homo sapi...	Homo sapiens
Q5R684	2.9e-105	99.3	Ubiquilin-1.	Pongo abelii
Q9UMX0	2.9e-105	99.3	Ubiquilin-1; Pr...	Homo sapiens
BAG51350	2.9e-105	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR006636	88	116	SM00727	Heat shock chaperonin-binding
	IPR006636	118	157	SM00727	Heat shock chaperonin-binding
	IPR006636	293	325	SM00727	Heat shock chaperonin-binding

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp