ORK04038

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04038

Order Kazusa clone(s) from :

Accession No	AK226148
Product ID	ORK04038
Clone name	ah04724
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ADAM33
cDNA sequence	DNA sequence (5181 bp) Predicted protein sequence (273 aa)
Description	ADAM 33 precursor (EC 3.4.24.-) (A disintegrin and metalloproteinase domain 33).

Features of the cloned cDNA sequence

Description

Length: 5181 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	992 bp
Genome contig ID	gi51511747r_3496920
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CCCTGTCTCTAAAATAAATTTTAAAAAGACATATT
Flanking genome sequence (99698 - 99649)	----+--------+--------+--------+--------+----* ACACTTGGACCTTGGTTAGTCTTTTCTGTATGTAAATTCAACCCATGGGG

Features of the protein sequence

Description

Length: 273 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX10521	2e-106	99.6	ADAM metallopep...	Homo sapiens
EAX10522	1.5e-63	87.0	ADAM metallopep...	Homo sapiens
EAX10523	2e-63	90.7	ADAM metallopep...	Homo sapiens
AAI25114	3.4e-63	90.7	ADAM33 protein ...	Homo sapiens
AAM80482	3.8e-63	90.7	a disintegrin a...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006586	16	112	PF08516	ADAM
HMMSmart	IPR006586	18	133	SM00608	ADAM
ScanRegExp	IPR013032	130	141	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	163	FLLAMLLSVLLPLLPGAGLAWCC	185	PRIMARY	23