ORK04428

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04428

Order Kazusa clone(s) from :

Accession No	AB209474
Product ID	ORK04428
Clone name	ah05167
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CAMK2G
cDNA sequence	DNA sequence (5953 bp) Predicted protein sequence (155 aa)
Description	Calcium/calmodulin-dependent protein kinase type II gamma chain (EC 2.7.11.17) (CaM-kinase II gamma chain) (CaM kinase II gamma subunit) (CaMK-II subunit gamma).

Features of the cloned cDNA sequence

Description

Length: 5953 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	409 bp
Genome contig ID	gi89161187r_75144064
PolyA signal sequence (None)	+--------+--------+----*----+---- GTCTCTGCTGTACTGAGGTGTTTTTTACATTTAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAGAAAAAAAGATTGTTTAAAAAAAAAAGGAATCCATACC

Features of the protein sequence

Description

Length: 155 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92711	1.7e-65	100.0	calcium/calmodu...	Homo sapiens
AAL69958	2.4e-37	71.7	CaM kinase II g...	Mustela putoriu...
AAC48714	1.2e-34	75.0	calcium/calmodu...	Sus scrofa
XP_863725	1.2e-34	75.0	similar to calc...	Canis lupus fam...
EAW54533	4.1e-34	81.5	calcium/calmodu...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013543	84	154	PF08332	Calcium/calmodulin dependent protein kinase II

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	5	CLLEMAGGQASVVIIGSAGVLGC	27	PRIMARY	23