ORK05214

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05214

Order Kazusa clone(s) from :

Accession No	AB209153
Product ID	ORK05214
Clone name	aj00184
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	FMN2
cDNA sequence	DNA sequence (5028 bp) Predicted protein sequence (1332 aa)
Description	Formin-2.

Features of the cloned cDNA sequence

Description

Length: 5028 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1029 bp
Genome contig ID	gi89161185f_238223215
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- AATAAAATGAATAATAAAAGAATAAAGATACTTGC
Flanking genome sequence (481893 - 481942)	----+--------+--------+--------+--------+----* AAAAGACAGCTGTCATATTTAACATGGGGTGGGGAATAAGAGAAGGAGGG

Features of the protein sequence

Description

Length: 1332 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92390	0	100.0	formin 2 varian...	Homo sapiens
Q9NZ56	0	99.4	Formin-2.	Homo sapiens
XP_001095731	9.3e-217	93.6	similar to form...	Macaca mulatta
XP_001095635	3.3e-216	93.5	similar to form...	Macaca mulatta
XP_001492593	3.3e-199	82.3	similar to form...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009408	421	584	PF06346	Formin Homology 1
	IPR009408	586	718	PF06346	Formin Homology 1
	IPR009408	719	868	PF06346	Formin Homology 1
	IPR015425	894	1283	PF02181	Actin-binding FH2
HMMSmart	IPR003104	413	1297	SM00498	Actin-binding FH2 and DRF autoregulatory
ProfileScan	IPR000591	139	209	PS50186	Pleckstrin/ G-protein
ScanRegExp	IPR001220	404	410	PS00307	Legume lectin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp