ORK06989

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06989

Order Kazusa clone(s) from :

Accession No	AB209155
Product ID	ORK06989
Clone name	aj00525
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SRPK3
cDNA sequence	DNA sequence (4479 bp) Predicted protein sequence (699 aa)
Description	Serine/threonine-protein kinase SRPK3 (EC 2.7.11.1) (Serine/arginine- rich protein specific kinase 3) (Serine/threonine-protein kinase 23) (Muscle-specific serine kinase 1) (MSSK-1).

Features of the cloned cDNA sequence

Description

Length: 4479 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	208 bp
Genome contig ID	gi89161218f_152595061
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- GTGTGTGTATTCCTTTCTTAATAAAGTGTGGACTG
Flanking genome sequence (109318 - 109367)	----+--------+--------+--------+--------+----* AACATCGGTGCCTGGAGTGAGGGAGGCCCACGCCAAGTCTAGGGAGAAGG

Features of the protein sequence

Description

Length: 699 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92392	0	100.0	serine/threonin...	Homo sapiens
AAH92416	7e-190	95.8	SFRS protein ki...	Homo sapiens
AAZ13757	7.1e-189	95.6	serine/threonin...	Homo sapiens
AAI23798	2.6e-180	91.6	SRPK3 protein [...	Bos taurus
Q9Z0G2	2.6e-179	92.1	Serine/threonin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	211	353	PD000001	Protein kinase
BlastProDom	IPR000719	538	621	PD000001	Protein kinase
HMMPfam	IPR000719	211	697	PF00069	Protein kinase
HMMSmart	IPR002290	211	697	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	211	697	PS50011	Protein kinase
ScanRegExp	IPR000719	217	240	PS00107	Protein kinase
ScanRegExp	IPR008271	340	352	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp