ORK04037

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04037

Order Kazusa clone(s) from :

Accession No	AB209157
Product ID	ORK04037
Clone name	aj00633
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ADAM15
cDNA sequence	DNA sequence (4508 bp) Predicted protein sequence (859 aa)
Description	ADAM 15 precursor (EC 3.4.24.-) (A disintegrin and metalloproteinase domain 15) (Metalloproteinase-like, disintegrin-like, and cysteine- rich protein 15) (MDC-15) (Metalloprotease RGD disintegrin protein) (Metargidin).

Features of the cloned cDNA sequence

Description

Length: 4508 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	273 bp
Genome contig ID	gi89161185f_153190046
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CTCAGTTGCAATAAACGTGACATCTTGGGAGCGTT
Flanking genome sequence (111831 - 111880)	----+--------+--------+--------+--------+----* CCCCAGAGTTTGTCTGCTTCTAGAACCCGGGTCGCTCCTGCTGCGGTTCC

Features of the protein sequence

Description

Length: 859 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92394	100.0	ADAM15 isoform ...	Homo sapiens
AAS48594	98.8	ADAM15 isoform ...	Homo sapiens
NP_997079	98.7	disintegrin and...	Homo sapiens
AAS48595	98.7	ADAM15 isoform ...	Homo sapiens
NP_997080	98.5	disintegrin and...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001762	458	498	PD000664	Blood coagulation inhibitor
HMMPfam	IPR002870	5	164	PF01562	Peptidase M12B
	IPR001590	210	411	PF01421	Peptidase M12B
	IPR001762	427	503	PF00200	Blood coagulation inhibitor
	IPR006586	505	626	PF08516	ADAM
	IPR013111	654	681	PF07974	EGF
HMMSmart	IPR001762	427	503	SM00050	Blood coagulation inhibitor
HMMSmart	IPR006586	504	646	SM00608	ADAM
ProfileScan	IPR001590	210	411	PS50215	Peptidase M12B
	IPR001762	418	505	PS50214	Blood coagulation inhibitor
	IPR000742	650	682	PS50026	EGF-like
ScanRegExp	IPR006025	342	351	PS00142	Peptidase M
ScanRegExp	IPR013032	670	681	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	4	SPPALLSIPSVLSWGVLGPAGG	25	SECONDARY	22
SOSUI2	2	689	SSLTTGLLLSLLVLLVLVMLGA	710	PRIMARY	22