ORK05905

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05905

Order Kazusa clone(s) from :

Accession No	AB209170
Product ID	ORK05905
Clone name	aj01273
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MAG
cDNA sequence	DNA sequence (4355 bp) Predicted protein sequence (661 aa)
Description	Myelin-associated glycoprotein precursor (Siglec-4a).

Features of the cloned cDNA sequence

Description

Length: 4355 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2368 bp
Genome contig ID	gi42406306f_40376978
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- CTCACAATAAAAATGGCTCAGATGCCACTTCAAAG
Flanking genome sequence (153126 - 153175)	----+--------+--------+--------+--------+----* AACCAGTGAACTCTTTTCAGTCTGTGGAGTCAGAGTGGGGATGAGGAGAG

Features of the protein sequence

Description

Length: 661 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92407	100.0	myelin associat...	Homo sapiens
XP_001111459	98.4	similar to myel...	Macaca mulatta
P20916	100.0	Myelin-associat...	Homo sapiens
BAD97282	99.8	myelin associat...	Homo sapiens
BAD96400	99.8	myelin associat...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013106	38	175	PF07686	Immunoglobulin V-set
	IPR013162	178	265	PF08205	CD80-like
	IPR013098	277	359	PF07679	Immunoglobulin I-set
	IPR013151	377	431	PF00047	Immunoglobulin
HMMSmart	IPR003599	64	172	SM00409	Immunoglobulin subtype
	IPR003599	181	274	SM00409	Immunoglobulin subtype
	IPR003599	283	360	SM00409	Immunoglobulin subtype
	IPR003598	289	349	SM00408	Immunoglobulin subtype 2
	IPR003599	369	447	SM00409	Immunoglobulin subtype
	IPR003598	375	436	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	178	264	PS50835	Immunoglobulin-like
	IPR007110	276	358	PS50835	Immunoglobulin-like
	IPR007110	366	445	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	34	SLYRMIFLTALPLFWIMISASR	55	PRIMARY	22
SOSUI2	2	549	AKIGPVGAVVAFAILIAIVCYIT	571	PRIMARY	23