ORK07549

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07549

Order Kazusa clone(s) from :

Accession No	AB209708
Product ID	ORK07549
Clone name	bh00385
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	MYH7
cDNA sequence	DNA sequence (4839 bp) Predicted protein sequence (1574 aa)
Description	Homo sapiens mRNA for myosin, heavy polypeptide 7, cardiac muscle, beta variant protein.

Features of the cloned cDNA sequence

Description

Length: 4839 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	113 bp
Genome contig ID	gi51511730r_22851790
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GAGGAAGCAGAATAAAGCAATTTTCCTTGAAGCCG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATCCTGACTCCAGACTCTTCTTCACTGCCCTGAGGACCCGGGGATGGG

Features of the protein sequence

Description

Length: 1574 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92945	100.0	myosin, heavy p...	Homo sapiens
P12883	100.0	Myosin-7; Myosi...	Homo sapiens
AAA51837	99.9	beta-myosin hea...	Homo sapiens
CAC20413	99.9	beta-myosin hea...	Homo sapiens
ABQ59035	99.8	MYH7 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	1257	1441	PD023692	NULL
FPrintScan	IPR001609	95	123	PR00193	Myosin head
FPrintScan	IPR001609	149	177	PR00193	Myosin head
HMMPfam	IPR001609	1	405	PF00063	Myosin head
	IPR000048	421	441	PF00612	IQ calmodulin-binding region
	IPR002928	707	1565	PF01576	Myosin tail
HMMSmart	IPR001609	1	418	SM00242	Myosin head
HMMSmart	IPR000048	419	441	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	420	449	PS50096	IQ calmodulin-binding region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp