Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06532
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209702
Product ID ORK06532
Clone name bj00338
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PTPRA
cDNA sequence DNA sequence (4465 bp)
Predicted protein sequence (651 aa)
Description Receptor-type tyrosine-protein phosphatase alpha precursor (EC 3.1.3.48) (Protein-tyrosine phosphatase alpha) (R-PTP-alpha).
Features of the cloned cDNA sequence

Length: 4465 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 535 bp
Genome contig ID gi51511747f_2702197
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
AGGGACTATCAGGTAATAAAAGCTTTGACTCCCTG
Flanking genome sequence
(265119 - 265168)		 
----+----*----+----*----+----*----+----*----+----*
AGGAAATGTCTCTCCCTTTGTCTGGGGGTGGGGCAGCCATACAGGCTGGG

Features of the protein sequence

Length: 651 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92939 0 100.0 protein tyrosin...
 Homo sapiens
XP_001158332 0 99.5 protein tyrosin...
 Pan troglodytes
XP_001114682 0 99.5 similar to prot...
 Macaca mulatta
CAA37447 0 99.5 tyrosine phosph...
 Homo sapiens
CAA38065 0 99.5 protein-tyrosin...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000242 143 150 PR00700 Protein-tyrosine phosphatase
IPR000242 159 179 PR00700 Protein-tyrosine phosphatase
IPR000242 247 264 PR00700 Protein-tyrosine phosphatase
IPR000242 286 304 PR00700 Protein-tyrosine phosphatase
IPR000242 607 622 PR00700 Protein-tyrosine phosphatase
IPR000242 623 633 PR00700 Protein-tyrosine phosphatase
HMMPfam IPR000242 114 349 PF00102 Protein-tyrosine phosphatase
IPR000242 407 639 PF00102 Protein-tyrosine phosphatase
HMMSmart IPR000242 89 352 SM00194 Protein-tyrosine phosphatase
IPR003595 248 349 SM00404 Protein-tyrosine phosphatase
IPR000242 381 642 SM00194 Protein-tyrosine phosphatase
IPR003595 537 639 SM00404 Protein-tyrosine phosphatase
ProfileScan IPR000242 90 350 PS50055 Protein-tyrosine phosphatase
IPR000387 270 341 PS50056 Protein-tyrosine phosphatase
IPR000242 382 640 PS50055 Protein-tyrosine phosphatase
IPR000387 556 631 PS50056 Protein-tyrosine phosphatase
ScanRegExp IPR000387 289 301 PS00383 Protein-tyrosine phosphatase
IPR000387 579 591 PS00383 Protein-tyrosine phosphatase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp