ORK06981

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06981

Order Kazusa clone(s) from :

Accession No	AK226167
Product ID	ORK06981
Clone name	bm01376
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	SQSTM1
cDNA sequence	DNA sequence (1799 bp) Predicted protein sequence (379 aa)
Description	Sequestosome-1 (Phosphotyrosine-independent ligand for the Lck SH2 domain of 62 kDa) (Ubiquitin-binding protein p62) (EBI3-associated protein of 60 kDa) (p60) (EBIAP).

Features of the cloned cDNA sequence

Description

Length: 1799 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	659 bp
Genome contig ID	gi51511721f_179082563
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- AAACAATCTAATTAAATGGCATCAGCACTTTAACC
Flanking genome sequence (114297 - 114346)	----+--------+--------+--------+--------+----* AATGACGTTTGCATAGAGAGAAATGATTGACAGTAAGTTTATTGTTAATG

Features of the protein sequence

Description

Length: 379 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001152500	2.7e-137	99.7	sequestosome 1 ...	Pan troglodytes
Q13501	3e-137	99.7	Sequestosome-1;...	Homo sapiens
XP_518154	3e-137	99.7	sequestosome 1 ...	Pan troglodytes
XP_001152700	4.4e-137	100.0	sequestosome 1 ...	Pan troglodytes
XP_001152826	4.6e-137	100.0	sequestosome 1 ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000270	7	41	PF00564	Octicosapeptide/Phox/Bem1p
HMMPfam	IPR000433	61	105	PF00569	Zinc finger
HMMSmart	IPR000433	61	104	SM00291	Zinc finger
HMMSmart	IPR000449	333	372	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan	IPR000433	61	106	PS50135	Zinc finger
ProfileScan	IPR000449	328	373	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
ScanRegExp	IPR000433	67	93	PS01357	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp