Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04045
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209717
Product ID ORK04045
Clone name bm01890
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ADAMTS8
cDNA sequence DNA sequence (1891 bp)
Predicted protein sequence (418 aa)
Description ADAMTS-8 precursor (EC 3.4.24.-) (A disintegrin and metalloproteinase with thrombospondin motifs 8) (ADAM-TS 8) (ADAM-TS8) (METH-2) (METH- 8).
Features of the cloned cDNA sequence

Length: 1891 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 633 bp
Genome contig ID gi51511727r_129680030
PolyA signal sequence
(ACTAAA,-21)		 
+----*----+----*----+----*----+----
AAATGTGTCTCTGAACTAAAGTGTGATCTTATGCC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AATGCAGTGGTCTGGTCTGATTCATTGTTTCTTTGGAAAGGGCAGCAACC

Features of the protein sequence

Length: 418 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92954 5e-183 100.0 ADAMTS-8 precur...
 Homo sapiens
Q9UP79 1.8e-182 99.7 A disintegrin a...
 Homo sapiens
EAW67783 3e-182 99.5 ADAM metallopep...
 Homo sapiens
EAW67785 3.8e-182 99.5 ADAM metallopep...
 Homo sapiens
AAH89435 3.8e-182 99.5 ADAMTS8 protein...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR008085 56 69 PR01705 Thrombospondin
IPR013273 64 82 PR01857 Peptidase M12B
IPR008085 74 85 PR01705 Thrombospondin
IPR008085 93 104 PR01705 Thrombospondin
IPR013273 179 198 PR01857 Peptidase M12B
IPR013273 199 218 PR01857 Peptidase M12B
HMMPfam IPR000884 59 109 PF00090 Thrombospondin
IPR010294 219 338 PF05986 ADAM-TS Spacer 1
IPR000884 365 416 PF00090 Thrombospondin
HMMSmart IPR000884 58 110 SM00209 Thrombospondin
IPR000884 364 417 SM00209 Thrombospondin
ProfileScan IPR000884 55 110 PS50092 Thrombospondin
IPR000884 362 417 PS50092 Thrombospondin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp