Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05929
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209720
Product ID ORK05929
Clone name bm02321
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MAPK8IP1
cDNA sequence DNA sequence (1693 bp)
Predicted protein sequence (316 aa)
Description C-jun-amino-terminal kinase-interacting protein 1 (JNK-interacting protein 1) (JIP-1) (JNK MAP kinase scaffold protein 1) (Islet-brain 1) (IB-1) (Mitogen-activated protein kinase 8-interacting protein 1).
Features of the cloned cDNA sequence

Length: 1693 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 740 bp
Genome contig ID gi51511727f_45781078
PolyA signal sequence
(ATTAAA,-21)		 
+----*----+----*----+----*----+----
CCCTGGCCCCAACTATTAAAGTGCCATTTCCTGTC
Flanking genome sequence
(103512 - 103561)		 
----+----*----+----*----+----*----+----*----+----*
TGGACTGCAGTGGATGTATCTGCATGGGCCCCTCCCGTCCCCGTCTCGCT

Features of the protein sequence

Length: 316 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92957 8.1e-141 100.0 mitogen-activat...
 Homo sapiens
BAE72919 1.1e-140 100.0 hypothetical pr...
 Macaca fascicularis
XP_508390 1.5e-140 100.0 similar to JIP-...
 Pan troglodytes
XP_001113132 1.5e-140 100.0 mitogen-activat...
 Macaca mulatta
XP_001160866 1.5e-140 100.0 mitogen-activat...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001452 96 148 PF00018 Src homology-3
IPR006020 172 306 PF00640 Phosphotyrosine interaction region
HMMSmart IPR001452 96 153 SM00326 Src homology-3
IPR006020 167 309 SM00462 Phosphotyrosine interaction region
ProfileScan IPR001452 93 154 PS50002 Src homology-3
IPR006020 171 305 PS01179 Phosphotyrosine interaction region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp