Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07259
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209724
Product ID ORK07259
Clone name bm02387
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TXNRD2
cDNA sequence DNA sequence (1891 bp)
Predicted protein sequence (511 aa)
Description Thioredoxin reductase 2, mitochondrial precursor (EC 1.8.1.9) (TR3) (TR-beta) (Selenoprotein Z) (SelZ).
Features of the cloned cDNA sequence

Length: 1891 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 355 bp
Genome contig ID gi89161203r_18143047
PolyA signal sequence
(AATAAA,-22)		 
+----*----+----*----+----*----+----
TTTCTGCAATGCAAATAAAGAGGGTACTTTTTCTG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAGTGTGCTCTGCCTGCGGTGTCCCTGATGGTCCCCCAGGATCGCCCAGG

Features of the protein sequence

Length: 511 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92961 5.5e-211 100.0 thioredoxin red...
 Homo sapiens
BAA77601 1e-210 99.8 thioredoxin red...
 Homo sapiens
AAD19597 1.3e-210 99.8 thioredoxin red...
 Homo sapiens
AAD25167 2.4e-210 99.6 thioredoxin red...
 Homo sapiens
Q9NNW7 2.4e-210 99.6 Thioredoxin red...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001327 177 248 PD000139 Pyridine nucleotide-disulphide oxidoreductase
FPrintScan IPR013027 30 52 PR00368 FAD-dependent pyridine nucleotide-disulphide oxidoreductase
IPR001100 30 52 PR00411 Pyridine nucleotide-disulphide oxidoreductase
IPR000815 40 58 PR00945 Mercuric reductase
IPR001100 71 86 PR00411 Pyridine nucleotide-disulphide oxidoreductase
IPR013027 173 182 PR00368 FAD-dependent pyridine nucleotide-disulphide oxidoreductase
IPR001100 173 182 PR00411 Pyridine nucleotide-disulphide oxidoreductase
IPR013027 209 234 PR00368 FAD-dependent pyridine nucleotide-disulphide oxidoreductase
IPR000815 209 226 PR00945 Mercuric reductase
IPR001100 209 234 PR00411 Pyridine nucleotide-disulphide oxidoreductase
IPR000815 229 244 PR00945 Mercuric reductase
IPR013027 299 313 PR00368 FAD-dependent pyridine nucleotide-disulphide oxidoreductase
IPR001100 299 313 PR00411 Pyridine nucleotide-disulphide oxidoreductase
IPR013027 343 350 PR00368 FAD-dependent pyridine nucleotide-disulphide oxidoreductase
IPR001100 343 350 PR00411 Pyridine nucleotide-disulphide oxidoreductase
IPR001100 380 401 PR00411 Pyridine nucleotide-disulphide oxidoreductase
IPR001100 449 464 PR00411 Pyridine nucleotide-disulphide oxidoreductase
IPR001100 471 491 PR00411 Pyridine nucleotide-disulphide oxidoreductase
HMMPfam IPR013027 30 354 PF07992 FAD-dependent pyridine nucleotide-disulphide oxidoreductase
IPR001327 209 306 PF00070 Pyridine nucleotide-disulphide oxidoreductase
IPR004099 384 497 PF02852 Pyridine nucleotide-disulphide oxidoreductase dimerisation region
HMMTigr IPR006338 27 511 TIGR01438 Thioredoxin and glutathione reductase selenoprotein
ScanRegExp IPR012999 72 82 PS00076 Pyridine nucleotide-disulphide oxidoreductase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp