ORK04669

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04669

Order Kazusa clone(s) from :

Accession No	AB209793
Product ID	ORK04669
Clone name	bm03027
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CTCF
cDNA sequence	DNA sequence (2797 bp) Predicted protein sequence (443 aa)
Description	Transcriptional repressor CTCF (CCCTC-binding factor) (CTCFL paralog) (11-zinc finger protein).

Features of the cloned cDNA sequence

Description

Length: 2797 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1296 bp
Genome contig ID	gi51511732f_66053977
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TCTACTGCTGTACAGCTAATAAATCATAACGGATT
Flanking genome sequence (176597 - 176646)	----+--------+--------+--------+--------+----* AACAAGTGCTCCAAAGACTCCATCTTGCGTGATTCCTGCCTGCTTGAGGG

Features of the protein sequence

Description

Length: 443 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93030	1.3e-146	100.0	CCCTC-binding f...	Homo sapiens
P49711	2.6e-136	98.1	Transcriptional...	Homo sapiens
AAP36268	2.6e-136	98.1	CCCTC-binding f...	synthetic construct
EAW83144	2.6e-136	98.1	CCCTC-binding f...	Homo sapiens
XP_536815	4.5e-136	97.8	similar to Tran...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	38	61	PF00096	Zinc finger
	IPR007087	67	89	PF00096	Zinc finger
	IPR007087	95	117	PF00096	Zinc finger
	IPR007087	123	146	PF00096	Zinc finger
	IPR007087	153	176	PF00096	Zinc finger
	IPR007087	183	205	PF00096	Zinc finger
	IPR007087	211	233	PF00096	Zinc finger
	IPR007087	239	262	PF00096	Zinc finger
	IPR007087	271	293	PF00096	Zinc finger
HMMSmart	IPR015880	38	61	SM00355	Zinc finger
	IPR015880	67	89	SM00355	Zinc finger
	IPR015880	95	117	SM00355	Zinc finger
	IPR015880	123	146	SM00355	Zinc finger
	IPR015880	153	176	SM00355	Zinc finger
	IPR015880	183	205	SM00355	Zinc finger
	IPR015880	211	233	SM00355	Zinc finger
	IPR015880	239	262	SM00355	Zinc finger
	IPR015880	271	291	SM00355	Zinc finger
ProfileScan	IPR007087	38	66	PS50157	Zinc finger
	IPR007087	67	94	PS50157	Zinc finger
	IPR007087	95	122	PS50157	Zinc finger
	IPR007087	123	151	PS50157	Zinc finger
	IPR007087	153	181	PS50157	Zinc finger
	IPR007087	183	210	PS50157	Zinc finger
	IPR007087	211	238	PS50157	Zinc finger
	IPR007087	239	262	PS50157	Zinc finger
	IPR007087	271	289	PS50157	Zinc finger
ScanRegExp	IPR007087	40	61	PS00028	Zinc finger
	IPR007087	125	146	PS00028	Zinc finger
	IPR007087	155	176	PS00028	Zinc finger
	IPR007087	185	205	PS00028	Zinc finger
	IPR007087	213	233	PS00028	Zinc finger
	IPR007087	241	262	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp