Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04187
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209795
Product ID ORK04187
Clone name bm03184
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ASB3
cDNA sequence DNA sequence (1842 bp)
Predicted protein sequence (340 aa)
Description Ankyrin repeat and SOCS box protein 3 (ASB-3).
Features of the cloned cDNA sequence

Length: 1842 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 755 bp
Genome contig ID gi89161199r_53650960
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TGAGAATGTTTATGTTTACAACTAGCCTTCCCAGT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAATTGTAAACATCACTTATATTACTT

Features of the protein sequence

Length: 340 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93032 6.1e-151 100.0 ankyrin repeat ...
 Homo sapiens
AAI10916 3.9e-147 99.1 ASB3 protein [H...
 Homo sapiens
BAE01031 5.7e-145 97.9 unnamed protein...
 Macaca fascicularis
Q9Y575 1.7e-144 99.0 Ankyrin repeat ...
 Homo sapiens
BAD96315 3.2e-144 98.7 ankyrin repeat ...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002110 89 101 PR01415 Ankyrin
IPR002110 101 113 PR01415 Ankyrin
HMMPfam IPR002110 26 51 PF00023 Ankyrin
IPR002110 52 80 PF00023 Ankyrin
IPR002110 88 120 PF00023 Ankyrin
IPR002110 121 149 PF00023 Ankyrin
IPR002110 155 187 PF00023 Ankyrin
IPR002110 188 220 PF00023 Ankyrin
IPR002110 221 253 PF00023 Ankyrin
IPR002110 260 277 PF00023 Ankyrin
IPR002110 289 321 PF00023 Ankyrin
HMMSmart IPR002110 19 48 SM00248 Ankyrin
IPR002110 52 81 SM00248 Ankyrin
IPR002110 88 117 SM00248 Ankyrin
IPR002110 121 150 SM00248 Ankyrin
IPR002110 155 184 SM00248 Ankyrin
IPR002110 188 217 SM00248 Ankyrin
IPR002110 221 250 SM00248 Ankyrin
IPR002110 256 286 SM00248 Ankyrin
IPR002110 289 318 SM00248 Ankyrin
ProfileScan IPR002110 19 51 PS50088 Ankyrin
IPR002110 19 321 PS50297 Ankyrin
IPR002110 88 120 PS50088 Ankyrin
IPR002110 121 153 PS50088 Ankyrin
IPR002110 155 187 PS50088 Ankyrin
IPR002110 188 220 PS50088 Ankyrin
IPR002110 221 253 PS50088 Ankyrin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp