ORK07195

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07195

Order Kazusa clone(s) from :

Accession No	AB209805
Product ID	ORK07195
Clone name	bm03803
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	TRAP1
cDNA sequence	DNA sequence (2205 bp) Predicted protein sequence (703 aa)
Description	Heat shock protein 75 kDa, mitochondrial precursor (HSP 75) (Tumor necrosis factor type 1 receptor-associated protein) (TRAP-1) (TNFR- associated protein 1).

Features of the cloned cDNA sequence

Description

Length: 2205 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	91 bp
Genome contig ID	gi51511732r_3548040
PolyA signal sequence (None)	+--------+--------+----*----+---- TTATTTACCTAAATTTAAAGGTATTTCTTAACCCG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGTGTGTTGGGCTTTTTTTCTGGGTCCTGTGGCAGGATGGGTCCTCTC

Features of the protein sequence

Description

Length: 703 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD93042	100.0	TNF receptor-as...	Homo sapiens
Q12931	99.8	Heat shock prot...	Homo sapiens
BAD96925	99.7	TNF receptor-as...	Homo sapiens
AAF15314	99.7	tumor necrosis ...	Homo sapiens
BAD96769	99.5	TNF receptor-as...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001404	85	105	PR00775	Heat shock protein Hsp90
	IPR001404	106	128	PR00775	Heat shock protein Hsp90
	IPR001404	152	169	PR00775	Heat shock protein Hsp90
	IPR001404	170	187	PR00775	Heat shock protein Hsp90
	IPR001404	197	219	PR00775	Heat shock protein Hsp90
	IPR001404	248	265	PR00775	Heat shock protein Hsp90
	IPR001404	266	284	PR00775	Heat shock protein Hsp90
HMMPfam	IPR003594	107	259	PF02518	ATP-binding region
HMMPfam	IPR001404	463	610	PF00183	Heat shock protein Hsp90
HMMSmart	IPR003594	107	260	SM00387	ATP-binding region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp