ORK11274

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11274

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11274
Clone name	bm05134
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	SLC9A3R1
cDNA sequence	DNA sequence (1967 bp) Predicted protein sequence (423 aa)
HaloTag ORF Clone	FHC11274
Flexi ORF Clone	FXC11274
Description	solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1

Features of the cloned cDNA sequence

Description

Length: 1967 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	694 bp
Genome contig ID	gi51511734f_70156385
PolyA signal sequence (None)	+--------+--------+----*----+---- AAGGAAACACTTTCAGAAATTCAGCTGGTTCCTCC
Flanking genome sequence (120701 - 120750)	----+--------+--------+--------+--------+----* AAACCCTTCAGCCTCCGTGTGTTCCTTGGAAGTTTTGTCCTCTGGCCTTG

Features of the protein sequence

Description

Length: 423 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH49220	3.1e-150	99.7	SLC9A3R1 protei...	Homo sapiens
XP_001092275	2.4e-141	95.2	solute carrier ...	Macaca mulatta
O14745	1.1e-124	100.0	Na(+)/H(+) exch...	Homo sapiens
BAG35400	3e-124	99.7	unnamed protein...	Homo sapiens
XP_511663	4.5e-124	99.4	similar to SLC9...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	79	156	PF00595	PDZ/DHR/GLGF
	IPR001478	219	296	PF00595	PDZ/DHR/GLGF
	IPR015098	383	423	PF09007	EBP50
HMMSmart	IPR001478	87	159	SM00228	PDZ/DHR/GLGF
HMMSmart	IPR001478	227	299	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	79	159	PS50106	PDZ/DHR/GLGF
ProfileScan	IPR001478	219	299	PS50106	PDZ/DHR/GLGF

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp