ORK11960

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11960

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11960
Clone name	bn03581
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
Symbol	TPT1
cDNA sequence	DNA sequence (817 bp) Predicted protein sequence (182 aa)
Description	tumor protein, translationally-controlled 1

Features of the cloned cDNA sequence

Description

Length: 817 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	208 bp
Genome contig ID	gi51511729r_44709313
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TGTAGGTTGTCTAAAAATAAAATGCATTTAAACTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGAGAGAATGCCTTTTAGTTTAATGCATATTTAAACTAAATTGATCC

Features of the protein sequence

Description

Length: 182 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P13693	8e-69	100.0	Translationally...	Homo sapiens
1YZ1	8.1e-69	100.0	Translationally...	Homo sapiens
EAX08733	8.2e-69	100.0	tumor protein, ...	Homo sapiens
EFB25528	8.3e-69	100.0	hypothetical pr...	Ailuropoda mela...
2HR9	8.3e-69	100.0	Translationally...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001983	19	181	PD004329	Translationally controlled tumour-associated TCTP
FPrintScan	IPR001983	11	31	PR01653	Translationally controlled tumour-associated TCTP
	IPR001983	59	70	PR01653	Translationally controlled tumour-associated TCTP
	IPR001983	72	91	PR01653	Translationally controlled tumour-associated TCTP
HMMPfam	IPR001983	11	179	PF00838	Translationally controlled tumour-associated TCTP
ScanRegExp	IPR001983	58	68	PS01002	Translationally controlled tumour-associated TCTP
ScanRegExp	IPR001983	139	161	PS01003	Translationally controlled tumour-associated TCTP

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp