ORK07123

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07123

Order Kazusa clone(s) from :

Accession No	AB209854
Product ID	ORK07123
Clone name	ef01529
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	TLE1
cDNA sequence	DNA sequence (7250 bp) Predicted protein sequence (636 aa)
Description	Transducin-like enhancer protein 1 (ESG1) (E(Sp1) homolog).

Features of the cloned cDNA sequence

Description

Length: 7250 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	4125 bp
Genome contig ID	gi89161216r_83288420
PolyA signal sequence (AGTAAA,-21)	+--------+--------+----*----+---- ATTTGGTTTATTACAGTAAAGGCTTTAGTACCAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTGGTTTTCCTTTTCTTTCTTTATTGTTTTTTATTAAAGCTTTGGGAT

Features of the protein sequence

Description

Length: 636 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93091	1.7e-203	100.0	transducin-like...	Homo sapiens
Q04724	3.1e-194	99.6	Transducin-like...	Homo sapiens
ACE87220	5.5e-194	99.5	transducin-like...	synthetic construct
XP_001495923	7.7e-194	99.3	transducin-like...	Equus caballus
XP_001103848	1e-192	99.0	similar to tran...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008165	348	414	PD003992	Protein of unknown function GLTT
HMMPfam	IPR005617	28	163	PF03920	Groucho/TLE
	IPR001680	501	537	PF00400	WD40 repeat
	IPR001680	557	584	PF00400	WD40 repeat
	IPR001680	590	628	PF00400	WD40 repeat
HMMSmart	IPR001680	500	537	SM00320	WD40 repeat
	IPR001680	543	584	SM00320	WD40 repeat
	IPR001680	589	628	SM00320	WD40 repeat
ProfileScan	IPR001680	506	636	PS50294	WD40 repeat
ProfileScan	IPR001680	596	636	PS50082	WD40 repeat
ScanRegExp	IPR001680	615	629	PS00678	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp