Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06401
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209875
Product ID ORK06401
Clone name ef04295
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PLK3
cDNA sequence DNA sequence (7409 bp)
Predicted protein sequence (621 aa)
Description Serine/threonine-protein kinase PLK3 (EC 2.7.11.21) (Polo-like kinase 3) (PLK-3) (Cytokine-inducible serine/threonine-protein kinase) (FGF- inducible kinase) (Proliferation-related kinase).
Features of the cloned cDNA sequence

Length: 7409 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 5542 bp
Genome contig ID gi89161185f_44938648
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
ATTCCAGCCTGGGTGACAGAGCAAGACTTGCCCTC
Flanking genome sequence
(110833 - 110882)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAGAAAGTGTGATAGAGAAGCGTGAATGGTGCC

Features of the protein sequence

Length: 621 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93112 0 100.0 polo-like kinas...
 Homo sapiens
Q9H4B4 0 95.5 Serine/threonin...
 Homo sapiens
AAH13899 0 95.3 Polo-like kinas...
 Homo sapiens
AAC50637 0 98.0 putative serine...
 Homo sapiens
AAX43274 0 98.0 polo-like kinas...
 synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 37 289 PD000001 Protein kinase
HMMPfam IPR000719 37 289 PF00069 Protein kinase
IPR000959 445 508 PF00659 POLO box duplicated region
IPR000959 542 612 PF00659 POLO box duplicated region
HMMSmart IPR001245 37 289 SM00219 Tyrosine protein kinase
IPR002290 37 289 SM00220 Serine/threonine protein kinase
ProfileScan IPR000719 37 289 PS50011 Protein kinase
IPR000959 445 508 PS50078 POLO box duplicated region
IPR000959 542 612 PS50078 POLO box duplicated region
ScanRegExp IPR000719 43 75 PS00107 Protein kinase
IPR008271 156 168 PS00108 Serine/threonine protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp