Length: 2108 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
1531 bp |
Genome contig ID |
gi89161210f_36654477 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- CAGCAGGTGCTCAATAAATGATTCTTAGTGACTTT |
Flanking genome sequence (108611 - 108660) |
----+----*----+----*----+----*----+----*----+----* ACTTGTAATATTACTATTGTGGTTATTATACCTTATAAGAACAAATAAAT |
Length: 191 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD93118 |
6.5e-79 |
100.0 |
Cyclin-dependen...
|
Homo sapiens
|
AAB59559 |
1.5e-74 |
99.4 |
cyclin-dependen...
|
Homo sapiens
|
AAB59560 |
4.9e-74 |
98.8 |
cyclin-dependen...
|
Homo sapiens
|
BAG10980 |
1.8e-67 |
100.0 |
cyclin-dependen...
|
synthetic construct
|
EAX03906 |
2.6e-67 |
98.7 |
cyclin-dependen...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Search method |
interpro_ID |
From |
To |
Entry |
Definition |
HMMPfam |
IPR003175 |
46 |
96 |
PF02234 |
Cyclin-dependent kinase inhibitor |