ORK04727

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04727

Order Kazusa clone(s) from :

Accession No	AB209884
Product ID	ORK04727
Clone name	eg00004
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	DDX10
cDNA sequence	DNA sequence (6706 bp) Predicted protein sequence (845 aa)
Description	Probable ATP-dependent RNA helicase DDX10 (EC 3.6.1.-) (DEAD box protein 10).

Features of the cloned cDNA sequence

Description

Length: 6706 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4166 bp
Genome contig ID	gi51511727f_107941059
PolyA signal sequence (None)	+--------+--------+----*----+---- CACTCCAGCCTGGAGACAGAGCAAGACTCCATCTC
Flanking genome sequence (357123 - 357172)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAGAGAGAGAGAGAGAGAGAAGAAAGCGAA

Features of the protein sequence

Description

Length: 845 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD93121	100.0	DEAD (Asp-Glu-A...	Homo sapiens
Q13206	100.0	Probable ATP-de...	Homo sapiens
AAC50823	99.6	similar to DEAD...	Homo sapiens
XP_001141618	99.1	DEAD (Asp-Glu-A...	Pan troglodytes
XP_001499618	90.8	similar to DEAD...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	103	273	PF00270	DNA/RNA helicase
HMMPfam	IPR001650	344	420	PF00271	DNA/RNA helicase
HMMSmart	IPR014001	98	301	SM00487	DEAD-like helicases
HMMSmart	IPR001650	337	420	SM00490	DNA/RNA helicase
ProfileScan	IPR014014	79	107	PS51195	RNA helicase
	IPR014021	110	284	PS51192	Helicase
	IPR001650	297	458	PS51194	DNA/RNA helicase
ScanRegExp	IPR000629	230	238	PS00039	RNA helicase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp