ORK10400

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10400

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10400
Clone name	ek00105
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CAPRIN2
cDNA sequence	DNA sequence (3267 bp) Predicted protein sequence (829 aa)
Description	Caprin-2 (Cytoplasmic activation/proliferation-associated protein 2)(C1q domain-containing protein 1)(EEG-1)(Gastric cancer multidrug resistance-associated protein)

Features of the cloned cDNA sequence

Description

Length: 3267 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	348 bp
Genome contig ID	gi89161190r_30653755
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATGCCTTGTTGTGCCTCAATAAAAAAGTTACATGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTTCAGTGTTCCTATTTAATTAAACATTTAGTTGAGAGGTAAAATATC

Features of the protein sequence

Description

Length: 829 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW96616	99.8	C1q domain cont...	Homo sapiens
DAA01120	99.8	TPA_exp: cytopl...	Homo sapiens
XP_520819	99.7	C1q domain cont...	Pan troglodytes
Q6IMN6	99.7	Caprin-2; Cytop...	Homo sapiens
XP_001082308	98.4	similar to C1q ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001073	712	738	PR00007	Complement C1q protein
	IPR001073	739	758	PR00007	Complement C1q protein
	IPR001073	786	807	PR00007	Complement C1q protein
	IPR001073	817	827	PR00007	Complement C1q protein
HMMPfam	IPR001073	701	826	PF00386	Complement C1q protein
HMMSmart	IPR001073	693	829	SM00110	Complement C1q protein
ProfileScan	IPR001073	695	829	PS50871	Complement C1q protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp