ORK12095

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK12095

Order Kazusa clone(s) from :

Accession No
Product ID	ORK12095
Clone name	ek00224
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	DIAPH2
cDNA sequence	DNA sequence (3582 bp) Predicted protein sequence (1108 aa)
Description	diaphanous homolog 2 (Drosophila)

Features of the cloned cDNA sequence

Description

Length: 3582 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	92 bp
Genome contig ID	gi89161218f_95726536
PolyA signal sequence (AGTAAA,-25)	+--------+--------+----*----+---- ATAATCAAGTAGTAAAAGTTTCTAGTGGAAACATG
Flanking genome sequence (884956 - 885005)	----+--------+--------+--------+--------+----* ATATTCATTTTGTCTGGTGCTCTTTTCTTTCTGCCTAAGGCTTTCTGATA

Features of the protein sequence

Description

Length: 1108 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI17415	100.0	DIAPH2 protein ...	Homo sapiens
AAI43839	99.9	DIAPH2 protein ...	Homo sapiens
CAA75869	99.3	DIA-12C protein...	Homo sapiens
EAX02793	99.2	diaphanous homo...	Homo sapiens
EAX02792	99.2	diaphanous homo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010473	103	297	PF06371	Diaphanous GTPase-binding
	IPR010472	301	494	PF06367	Diaphanous FH3
	IPR015425	641	1015	PF02181	Actin-binding FH2
	IPR010465	1066	1080	PF06345	DRF autoregulatory
HMMSmart	IPR003104	640	1083	SM00498	Actin-binding FH2 and DRF autoregulatory
ProfileScan	IPR014768	103	476	PS51232	GTPase-binding/formin homology 3
ProfileScan	IPR014767	1063	1093	PS51231	Diaphanous autoregulatory

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp