ORK05387

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05387

Order Kazusa clone(s) from :

Accession No	AB209490
Product ID	ORK05387
Clone name	ff03515
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	H2AFY
cDNA sequence	DNA sequence (10982 bp) Predicted protein sequence (192 aa)
Description	Core histone macro-H2A.1 (Histone macroH2A1) (mH2A1) (H2A.y) (H2A/y) (Medulloblastoma antigen MU-MB-50.205).

Features of the cloned cDNA sequence

Description

Length: 10982 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	595 bp
Genome contig ID	gi51511721r_134597970
PolyA signal sequence (AGTAAA,-19)	+--------+--------+----*----+---- TTGTGTGAGTTGATTTAGTAAAATGTTAAACCGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTTGTGACTGGTGTGTTCCAGTTATTGTGCCCGTGAGTCACAGGTCTTAA

Features of the protein sequence

Description

Length: 192 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92727	5.9e-79	100.0	H2A histone fam...	Homo sapiens
1ZR5	3.9e-71	99.4	H2AFY protein	Homo sapiens
AAN08620	6e-71	99.4	medulloblastoma...	Homo sapiens
AAC39908	6e-71	99.4	histone macroH2...	Homo sapiens
O75367	6e-71	99.4	Core histone ma...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002589	36	150	PF01661	Appr-1-p processing
HMMSmart	IPR002589	16	150	SM00506	Appr-1-p processing
ProfileScan	IPR002589	4	190	PS51154	Appr-1-p processing

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp