ORK07572

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07572

Order Kazusa clone(s) from :

Accession No	AK226162
Product ID	ORK07572
Clone name	ff11573
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HERC1
cDNA sequence	DNA sequence (12259 bp) Predicted protein sequence (3931 aa)
Description	guanine nucleotide exchange factor p532

Features of the cloned cDNA sequence

Description

Length: 12259 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	462 bp
Genome contig ID	gi51511731r_61587871
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CTTATGCAGAGAAATAAAGCAGATTCAGGAATTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCGTGGCTCTTGGTATTGCTTCCTGCGGAGCTTCTGACTAGGGGTTACC

Features of the protein sequence

Description

Length: 3931 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW77655	100.0	hect (homologou...	Homo sapiens
Q15751	99.8	Probable E3 ubi...	Homo sapiens
XP_001174017	99.6	guanine nucleot...	Pan troglodytes
XP_001918080	98.2	similar to Prob...	Equus caballus
XP_544717	98.1	similar to guan...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000408	3068	3084	PR00633	Regulator of chromosome condensation
	IPR000408	3209	3225	PR00633	Regulator of chromosome condensation
	IPR000408	3225	3239	PR00633	Regulator of chromosome condensation
	IPR000408	3317	3335	PR00633	Regulator of chromosome condensation
	IPR000408	3375	3396	PR00633	Regulator of chromosome condensation
HMMPfam	IPR003877	1139	1262	PF00622	SPla/RYanodine receptor SPRY
	IPR001680	2488	2526	PF00400	WD40 repeat
	IPR001680	2686	2724	PF00400	WD40 repeat
	IPR001680	2730	2774	PF00400	WD40 repeat
	IPR001680	2807	2845	PF00400	WD40 repeat
	IPR000408	3170	3219	PF00415	Regulator of chromosome condensation
	IPR000408	3222	3271	PF00415	Regulator of chromosome condensation
	IPR000408	3274	3324	PF00415	Regulator of chromosome condensation
	IPR000408	3379	3428	PF00415	Regulator of chromosome condensation
	IPR000569	3603	3915	PF00632	HECT
HMMSmart	IPR003877	1139	1260	SM00449	SPla/RYanodine receptor SPRY
	IPR001680	2487	2526	SM00320	WD40 repeat
	IPR001680	2642	2680	SM00320	WD40 repeat
	IPR001680	2685	2724	SM00320	WD40 repeat
	IPR001680	2729	2774	SM00320	WD40 repeat
	IPR001680	2806	2845	SM00320	WD40 repeat
	IPR000569	3569	3918	SM00119	HECT
ProfileScan	IPR001870	1072	1263	PS50188	B302
	IPR001680	2494	2535	PS50082	WD40 repeat
	IPR001680	2494	2854	PS50294	WD40 repeat
	IPR001680	2692	2723	PS50082	WD40 repeat
	IPR001680	2813	2854	PS50082	WD40 repeat
	IPR000408	3067	3115	PS50012	Regulator of chromosome condensation
	IPR000408	3116	3170	PS50012	Regulator of chromosome condensation
	IPR000408	3171	3222	PS50012	Regulator of chromosome condensation
	IPR000408	3223	3274	PS50012	Regulator of chromosome condensation
	IPR000408	3276	3327	PS50012	Regulator of chromosome condensation
	IPR000408	3328	3379	PS50012	Regulator of chromosome condensation
	IPR000408	3380	3431	PS50012	Regulator of chromosome condensation
	IPR000569	3571	3918	PS50237	HECT
ScanRegExp	IPR006162	2277	2292	PS00012	Phosphopantetheine attachment site
	IPR001680	2513	2527	PS00678	WD40 repeat
	IPR006035	2689	2697	PS00148	Ureohydrolase
	IPR000408	3209	3219	PS00626	Regulator of chromosome condensation
	IPR000408	3261	3271	PS00626	Regulator of chromosome condensation

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	130	GSMLCQIVNSLLLLPVSVARPLL	152	PRIMARY	23
SOSUI2	2	206	VWLVDLERTIALLIGRCLGGMLQ	228	SECONDARY	23