ORK06985

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06985

Order Kazusa clone(s) from :

Accession No	AB209128
Product ID	ORK06985
Clone name	fg01431
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SRF
cDNA sequence	DNA sequence (5672 bp) Predicted protein sequence (295 aa)
Description	Serum response factor (SRF).

Features of the cloned cDNA sequence

Description

Length: 5672 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4704 bp
Genome contig ID	gi89161210f_43147263
PolyA signal sequence (None)	+--------+--------+----*----+---- GAGCCCTGGCTCTGCCCCTCAGGGGGCCAGCTGGG
Flanking genome sequence (108132 - 108181)	----+--------+--------+--------+--------+----* GAGATGGGGGCTTCTTCCTCACACTGCTGTCCTCTCCCCCTTCAGCTCCT

Features of the protein sequence

Description

Length: 295 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92365	8.8e-94	100.0	serum response ...	Homo sapiens
P11831	1.4e-79	100.0	Serum response ...	Homo sapiens
XP_518487	2.1e-79	99.6	serum response ...	Pan troglodytes
XP_001093365	6.9e-79	98.8	serum response ...	Macaca mulatta
XP_612306	7.8e-78	97.7	similar to Seru...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002100	153	173	PR00404	Transcription factor
	IPR002100	173	188	PR00404	Transcription factor
	IPR002100	188	209	PR00404	Transcription factor
HMMPfam	IPR002100	159	209	PF00319	Transcription factor
HMMSmart	IPR002100	151	210	SM00432	Transcription factor
ProfileScan	IPR002100	151	211	PS50066	Transcription factor
ScanRegExp	IPR002100	153	207	PS00350	Transcription factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp