ORK00981

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00981

Order Kazusa clone(s) from :

Accession No	AB210005
Product ID	ORK00981
Clone name	fg04081
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MEF2D
cDNA sequence	DNA sequence (6228 bp) Predicted protein sequence (525 aa)
HaloTag ORF Clone	FHC00981
Flexi ORF Clone	FXC00981
Description	Myocyte-specific enhancer factor 2D.

Features of the cloned cDNA sequence

Description

Length: 6228 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4256 bp
Genome contig ID	gi89161185r_154600144
PolyA signal sequence (ATTAAA,-30)	+--------+--------+----*----+---- TTACTATTAAAAGAAAAAGAATACACGTTTCTGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTCGGCGTGGGTTTTGGTTTCTTTGGTGCCGCGAGGATGGGAAGGAAG

Features of the protein sequence

Description

Length: 525 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE06087	9.2e-139	100.0	MEF2D variant p...	Homo sapiens
BAG10218	4e-137	100.0	myocyte-specifi...	synthetic construct
Q14814	6.5e-137	99.8	Myocyte-specifi...	Homo sapiens
XP_001165500	1e-136	99.6	MADS box transc...	Pan troglodytes
EAW52951	1.3e-134	98.4	MADS box transc...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002100	8	28	PR00404	Transcription factor
	IPR002100	28	43	PR00404	Transcription factor
	IPR002100	43	64	PR00404	Transcription factor
HMMPfam	IPR002100	14	64	PF00319	Transcription factor
HMMSmart	IPR002100	6	65	SM00432	Transcription factor
ProfileScan	IPR002100	6	66	PS50066	Transcription factor
ScanRegExp	IPR002100	8	62	PS00350	Transcription factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp