ORK04441

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04441

Order Kazusa clone(s) from :

Accession No	AB209147
Product ID	ORK04441
Clone name	fg06951
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CASP9
cDNA sequence	DNA sequence (6173 bp) Predicted protein sequence (456 aa)
Description	Caspase-9 precursor (EC 3.4.22.62) (CASP-9) (ICE-like apoptotic protease 6) (ICE-LAP6) (Apoptotic protease Mch-6) (Apoptotic protease- activating factor 3) (APAF-3) [Contains: Caspase-9 subunit p35; Caspase-9 subunit p10].

Features of the cloned cDNA sequence

Description

Length: 6173 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4662 bp
Genome contig ID	gi89161185r_15587478
PolyA signal sequence (None)	+--------+--------+----*----+---- GCTGGGACTGCAGGCATGCACCACCATGGCTAATT
Flanking genome sequence (99844 - 99795)	----+--------+--------+--------+--------+----* AAAAAAAAAAATCTTTGTAAAGACAGAGTCTCGCTATGTTGCCCAGGCTG

Features of the protein sequence

Description

Length: 456 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92384	1.3e-197	100.0	caspase 9 isofo...	Homo sapiens
P55211	1.4e-165	97.2	Caspase-9; Shor...	Homo sapiens
AAP36282	1.4e-165	97.2	caspase 9, apop...	synthetic construct
AAO21133	7.7e-165	96.7	caspase 9, apop...	Homo sapiens
XP_513049	7.7e-165	96.7	caspase 9 isofo...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR015917	194	207	PR00376	Peptidase C14
	IPR015917	215	233	PR00376	Peptidase C14
	IPR015917	233	251	PR00376	Peptidase C14
	IPR015917	265	273	PR00376	Peptidase C14
	IPR015917	307	325	PR00376	Peptidase C14
	IPR015917	388	399	PR00376	Peptidase C14
HMMPfam	IPR001315	41	127	PF00619	Caspase Recruitment
HMMPfam	IPR011600	196	426	PF00656	Peptidase C14
HMMSmart	IPR001315	36	126	SM00114	Caspase Recruitment
HMMSmart	IPR015917	187	443	SM00115	Peptidase C14
ProfileScan	IPR001315	36	127	PS50209	Caspase Recruitment
	IPR001309	194	326	PS50208	Caspase
	IPR002138	366	432	PS50207	Peptidase C14
ScanRegExp	IPR001309	259	273	PS01121	Caspase
ScanRegExp	IPR001309	313	324	PS01122	Caspase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp