ORK06446

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06446

Order Kazusa clone(s) from :

Accession No	AB209314
Product ID	ORK06446
Clone name	fh03042
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PPFIA1
cDNA sequence	DNA sequence (5159 bp) Predicted protein sequence (696 aa)
Description	Liprin-alpha-1 (Protein tyrosine phosphatase receptor type f polypeptide-interacting protein alpha-1) (PTPRF-interacting protein alpha-1) (LAR-interacting protein 1) (LIP.1).

Features of the cloned cDNA sequence

Description

Length: 5159 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1397 bp
Genome contig ID	gi51511727f_69694527
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ATTGCTTTCTTTCAATAAAGTACTGAAGCATTTTC
Flanking genome sequence (213616 - 213665)	----+--------+--------+--------+--------+----* CACTGCCAATGAAGAATACTGAGAATAAGCTCTAACTGTTTTGGAAGGCA

Features of the protein sequence

Description

Length: 696 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92551	0	100.0	PTPRF interacti...	Homo sapiens
EAW74763	1.4e-179	98.4	protein tyrosin...	Homo sapiens
Q13136	1.7e-179	98.4	Liprin-alpha-1;...	Homo sapiens
XP_508612	1.9e-179	97.3	PTPRF interacti...	Pan troglodytes
AAH34046	5.9e-179	98.1	Protein tyrosin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	370	436	PF00536	Sterile alpha motif SAM
	IPR001660	455	519	PF00536	Sterile alpha motif SAM
	IPR011510	542	614	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001660	369	438	SM00454	Sterile alpha motif SAM
	IPR001660	454	521	SM00454	Sterile alpha motif SAM
	IPR001660	542	614	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	372	438	PS50105	Sterile alpha motif SAM
	IPR001660	464	521	PS50105	Sterile alpha motif SAM
	IPR001660	545	614	PS50105	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	374	GPTVVVWLELWVGMPAWYVAACR	396	PRIMARY	23