ORK07081

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07081

Order Kazusa clone(s) from :

Accession No	AB209317
Product ID	ORK07081
Clone name	fh04042
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TCOF1
cDNA sequence	DNA sequence (5195 bp) Predicted protein sequence (712 aa)
Description	Treacle protein (Treacher Collins syndrome protein).

Features of the cloned cDNA sequence

Description

Length: 5195 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3056 bp
Genome contig ID	gi51511721f_149634490
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCAACAGAGCAAAACTCTGTCTC
Flanking genome sequence (120184 - 120233)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAGGCAGCAGCAGAAACGTAGGCTCTGG

Features of the protein sequence

Description

Length: 712 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92554	3.8e-178	100.0	TCOF1 protein v...	Homo sapiens
EAW61737	8.8e-175	100.0	Treacher Collin...	Homo sapiens
AAH27252	9.5e-175	100.0	TCOF1 protein [...	Homo sapiens
EAW61739	1.1e-174	100.0	Treacher Collin...	Homo sapiens
EAW61738	1.2e-174	100.0	Treacher Collin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003993	185	203	PR01503	Treacher Collins syndrome protein Treacle
	IPR003993	206	219	PR01503	Treacher Collins syndrome protein Treacle
	IPR003993	228	251	PR01503	Treacher Collins syndrome protein Treacle
HMMPfam	IPR003993	7	111	PF03546	Treacher Collins syndrome protein Treacle
	IPR003993	125	184	PF03546	Treacher Collins syndrome protein Treacle
	IPR003993	185	574	PF03546	Treacher Collins syndrome protein Treacle

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp