ORK04151

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04151

Order Kazusa clone(s) from :

Accession No	AB209324
Product ID	ORK04151
Clone name	fh09382
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ARFGEF1
cDNA sequence	DNA sequence (5881 bp) Predicted protein sequence (1278 aa)
Description	Brefeldin A-inhibited guanine nucleotide-exchange protein 1 (Brefeldin A-inhibited GEP 1) (p200 ARF-GEP1) (p200 ARF guanine nucleotide exchange factor).

Features of the cloned cDNA sequence

Description

Length: 5881 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2043 bp
Genome contig ID	gi51511724r_68148458
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- ATTTGCTATAATAAACAGATAGTATTTTCAAAAGG
Flanking genome sequence (99843 - 99794)	----+--------+--------+--------+--------+----* ATAAAAAGCCTAAATTCCAGTTTTCTGGCCTACGTCATACGACCACACAT

Features of the protein sequence

Description

Length: 1278 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92561	100.0	brefeldin A-inh...	Homo sapiens
XP_001162042	99.9	brefeldin A-inh...	Pan troglodytes
Q9Y6D6	99.9	Brefeldin A-inh...	Homo sapiens
XP_519797	99.8	brefeldin A-inh...	Pan troglodytes
XP_001096475	99.7	similar to bref...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000904	173	360	PF01369	SEC7-like
HMMPfam	IPR015403	697	782	PF09324	Protein of unknown function DUF1981
HMMSmart	IPR000904	173	360	SM00222	SEC7-like
ProfileScan	IPR000904	169	358	PS50190	SEC7-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp