ORK06135

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06135

Order Kazusa clone(s) from :

Accession No	AB209336
Product ID	ORK06135
Clone name	fh11777
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NF1
cDNA sequence	DNA sequence (5691 bp) Predicted protein sequence (968 aa)
Description	Neurofibromin (Neurofibromatosis-related protein NF-1) [Contains: Neurofibromin truncated].

Features of the cloned cDNA sequence

Description

Length: 5691 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1398 bp
Genome contig ID	gi51511734f_26476235
PolyA signal sequence (None)	+--------+--------+----*----+---- CCAGCCTGGATGATAGAGTGAGACCCTTCTCTATT
Flanking genome sequence (206815 - 206864)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTTGTATATAAAAGC

Features of the protein sequence

Description

Length: 968 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92573	100.0	neurofibromin v...	Homo sapiens
XP_001174715	100.0	neurofibromin i...	Pan troglodytes
XP_001174734	100.0	neurofibromin i...	Pan troglodytes
AAA59924	100.0	GAP-related pro...	Homo sapiens
XP_001174729	100.0	neurofibromin i...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001936	306	480	PF00616	Ras GTPase-activating protein
HMMSmart	IPR001936	237	586	SM00323	Ras GTPase-activating protein
HMMSmart	IPR001251	612	764	SM00516	Cellular retinaldehyde-binding/triple function
ProfileScan	IPR001936	285	480	PS50018	Ras GTPase-activating protein
ProfileScan	IPR001251	609	767	PS50191	Cellular retinaldehyde-binding/triple function
ScanRegExp	IPR001936	436	450	PS00509	Ras GTPase-activating protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp