ORK07580

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07580

Order Kazusa clone(s) from :

Accession No	AB209341
Product ID	ORK07580
Clone name	fh12735
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DENND5B
cDNA sequence	DNA sequence (5461 bp) Predicted protein sequence (879 aa)
Description	MGC24039 protein.

Features of the cloned cDNA sequence

Description

Length: 5461 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2820 bp
Genome contig ID	gi89161190r_31329281
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAACCTGGGTGACAAGAGCGAGACTCCGTCTC
Flanking genome sequence (99704 - 99655)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGAAAAAAACTGCAGCCAAAGTTGGATTTGCGGCCTAT

Features of the protein sequence

Description

Length: 879 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92578	100.0	Hypothetical pr...	Homo sapiens
XP_520726	99.8	hypothetical pr...	Pan troglodytes
Q6ZUT9	99.8	DENN domain-con...	Homo sapiens
XP_001138253	99.8	hypothetical pr...	Pan troglodytes
BAC86129	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005112	103	179	PF03455	dDENN
	IPR004012	399	533	PF02759	RUN
	IPR001024	544	646	PF01477	Lipoxygenase
HMMSmart	IPR005112	103	179	SM00801	dDENN
	IPR004012	471	534	SM00593	RUN
	IPR004012	810	870	SM00593	RUN
ProfileScan	IPR005112	103	179	PS50947	dDENN
	IPR004012	377	537	PS50826	RUN
	IPR001024	541	649	PS50095	Lipoxygenase
	IPR004012	723	872	PS50826	RUN

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp