ORK05298

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05298

Order Kazusa clone(s) from :

Accession No	AB209354
Product ID	ORK05298
Clone name	fh14912
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	GLI2
cDNA sequence	DNA sequence (5197 bp) Predicted protein sequence (1121 aa)
Description	Zinc finger protein GLI2 (Tax helper protein).

Features of the cloned cDNA sequence

Description

Length: 5197 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1829 bp
Genome contig ID	gi89161199f_121352505
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- TTTTGTACATTAAAAAAGTAATTTTTTCATAATTT
Flanking genome sequence (114045 - 114094)	----+--------+--------+--------+--------+----* ATCTTGTCTATCTGCTTCCCCCTTGACAGTAGTTAATGAGAACCTGGGCA

Features of the protein sequence

Description

Length: 1121 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92591	100.0	GLI-Kruppel fam...	Homo sapiens
AAY87165	100.0	GLI-Kruppel tra...	Homo sapiens
EAW95248	99.9	hCG16239, isofo...	Homo sapiens
EAW95247	99.9	hCG16239, isofo...	Homo sapiens
BAA25666	99.5	hGLI2 [Homo sap...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	38	63	PD000003	Zinc finger
HMMPfam	IPR007087	38	62	PF00096	Zinc finger
	IPR007087	68	93	PF00096	Zinc finger
	IPR007087	99	124	PF00096	Zinc finger
HMMSmart	IPR015880	5	32	SM00355	Zinc finger
	IPR015880	38	62	SM00355	Zinc finger
	IPR015880	68	93	SM00355	Zinc finger
	IPR015880	99	124	SM00355	Zinc finger
ProfileScan	IPR007087	10	37	PS50157	Zinc finger
	IPR007087	38	67	PS50157	Zinc finger
	IPR007087	68	98	PS50157	Zinc finger
	IPR007087	99	129	PS50157	Zinc finger
ScanRegExp	IPR007087	40	62	PS00028	Zinc finger
	IPR007087	70	93	PS00028	Zinc finger
	IPR007087	101	124	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp