ORK05239

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05239

Order Kazusa clone(s) from :

Accession No	AB209366
Product ID	ORK05239
Clone name	fh16749
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	FUBP1
cDNA sequence	DNA sequence (5339 bp) Predicted protein sequence (493 aa)
Description	Far upstream element-binding protein 1 (FUSE-binding protein 1) (FBP) (DNA helicase V) (HDH V).

Features of the cloned cDNA sequence

Description

Length: 5339 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3857 bp
Genome contig ID	gi89161185r_78082329
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ATGGTTTCCTCAATAAATGTACATTGATGACTATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATAAAGGAGTGCTTTGTGTTTTTTATACATATATTACATGGTAAAATTTT

Features of the protein sequence

Description

Length: 493 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92603	1.4e-142	100.0	far upstream el...	Homo sapiens
XP_547322	2.5e-142	99.7	similar to Far ...	Canis lupus fam...
XP_001169014	2.8e-142	100.0	far upstream el...	Pan troglodytes
Q96AE4	2.8e-142	100.0	Far upstream el...	Homo sapiens
AAH17247	2.8e-142	100.0	FUBP1 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004088	37	101	PF00013	K Homology
	IPR004088	127	189	PF00013	K Homology
	IPR004088	228	293	PF00013	K Homology
	IPR015096	451	472	PF09005	Domain of unknown function DUF1897
HMMSmart	IPR004087	34	106	SM00322	K Homology
	IPR004087	124	194	SM00322	K Homology
	IPR004087	225	298	SM00322	K Homology
ProfileScan	IPR004088	35	101	PS50084	K Homology
	IPR004088	125	189	PS50084	K Homology
	IPR004088	226	293	PS50084	K Homology

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp