ORK06535

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06535

Order Kazusa clone(s) from :

Accession No	AB209368
Product ID	ORK06535
Clone name	fh17076
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PTPRN
cDNA sequence	DNA sequence (5099 bp) Predicted protein sequence (824 aa)
Description	Receptor-type tyrosine-protein phosphatase-like N precursor (R-PTP-N) (PTP IA-2) (Islet cell antigen 512) (ICA 512) (Islet cell autoantigen 3).

Features of the cloned cDNA sequence

Description

Length: 5099 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2066 bp
Genome contig ID	gi89161199r_219762591
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- TGTGAATAAAGTTAGTGTGTTGTCTGTGCAGCTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCCAGACTCCTACGCATTTCTGTCCGCTGTGCATCTGGACTCCAGCCC

Features of the protein sequence

Description

Length: 824 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92605	100.0	protein tyrosin...	Homo sapiens
Q16849	99.8	Receptor-type t...	Homo sapiens
XP_516107	99.1	protein tyrosin...	Pan troglodytes
CAH91678	97.9	hypothetical pr...	Pongo abelii
ABY67204	96.9	protein tyrosin...	Papio anubis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000242	735	742	PR00700	Protein-tyrosine phosphatase
FPrintScan	IPR000242	752	772	PR00700	Protein-tyrosine phosphatase
HMMPfam	IPR000242	706	809	PF00102	Protein-tyrosine phosphatase
HMMSmart	IPR000242	680	824	SM00194	Protein-tyrosine phosphatase
ProfileScan	IPR000242	681	810	PS50055	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	548	SVLLTLVALAGVAGLLVALAVAL	570	PRIMARY	23