ORK05555

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05555

Order Kazusa clone(s) from :

Accession No	AB209370
Product ID	ORK05555
Clone name	fh17232
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	JAG2
cDNA sequence	DNA sequence (5405 bp) Predicted protein sequence (180 aa)
Description	Jagged-2 precursor (Jagged2) (HJ2).

Features of the cloned cDNA sequence

Description

Length: 5405 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3838 bp
Genome contig ID	gi51511730r_104579122
PolyA signal sequence (None)	+--------+--------+----*----+---- GAAGCACTCTGTATATTTGATTGAATAATGCCACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCCGGCCTCCCTTGTTCTTTCGGTGCTGTCCCTTTTGTATTGAGAGTG

Features of the protein sequence

Description

Length: 180 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92607	3.4e-81	100.0	jagged 2 isofor...	Homo sapiens
NP_660142	2.1e-33	76.2	protein jagged-...	Homo sapiens
AAB84216	2.1e-33	76.2	hJAG2.del-E6 [H...	Homo sapiens
CAA74706	2.1e-33	76.2	jagged2 protein...	Homo sapiens
AAB84215	2.2e-33	76.2	Jagged2 [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR006552	29	89	SM00215	VWC out

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp