Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07468
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209371
Product ID ORK07468
Clone name fh17353
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF419
cDNA sequence DNA sequence (5597 bp)
Predicted protein sequence (487 aa)
Description Zinc finger protein 419A.
Features of the cloned cDNA sequence

Length: 5597 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 575 bp
Genome contig ID gi42406306f_62591145
PolyA signal sequence
(AATAAA,-22)		 
+----*----+----*----+----*----+----
TTAGATCTTCTTTAATAAATATTTATTTCCCATAC
Flanking genome sequence
(106702 - 106751)		 
----+----*----+----*----+----*----+----*----+----*
ACCCTTATGACCATTTCCAGAGACTGAATTGTGTTTTTATAATTTTCACC

Features of the protein sequence

Length: 487 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92608 1.1e-215 100.0 zinc finger pro...
 Homo sapiens
EAW72504 1.1e-215 100.0 zinc finger pro...
 Homo sapiens
Q96HQ0 2.4e-215 99.7 Zinc finger pro...
 Homo sapiens
NP_001091963 2.7e-215 99.5 zinc finger pro...
 Homo sapiens
NP_001091962 2.7e-215 99.5 zinc finger pro...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 180 202 PD000003 Zinc finger
IPR007087 208 231 PD000003 Zinc finger
IPR007087 236 259 PD000003 Zinc finger
IPR007087 264 287 PD000003 Zinc finger
IPR007087 292 315 PD000003 Zinc finger
IPR007087 320 343 PD000003 Zinc finger
IPR007087 348 371 PD000003 Zinc finger
IPR007087 376 399 PD000003 Zinc finger
IPR007087 404 426 PD000003 Zinc finger
IPR007087 432 455 PD000003 Zinc finger
IPR007087 460 483 PD000003 Zinc finger
HMMPfam IPR001909 4 44 PF01352 KRAB box
IPR007087 180 202 PF00096 Zinc finger
IPR007087 208 230 PF00096 Zinc finger
IPR007087 236 258 PF00096 Zinc finger
IPR007087 264 286 PF00096 Zinc finger
IPR007087 292 314 PF00096 Zinc finger
IPR007087 320 342 PF00096 Zinc finger
IPR007087 348 370 PF00096 Zinc finger
IPR007087 376 398 PF00096 Zinc finger
IPR007087 404 426 PF00096 Zinc finger
IPR007087 432 454 PF00096 Zinc finger
IPR007087 460 482 PF00096 Zinc finger
HMMSmart IPR001909 4 64 SM00349 KRAB box
IPR015880 180 202 SM00355 Zinc finger
IPR015880 208 230 SM00355 Zinc finger
IPR015880 236 258 SM00355 Zinc finger
IPR015880 264 286 SM00355 Zinc finger
IPR015880 292 314 SM00355 Zinc finger
IPR015880 320 342 SM00355 Zinc finger
IPR015880 348 370 SM00355 Zinc finger
IPR015880 376 398 SM00355 Zinc finger
IPR015880 404 426 SM00355 Zinc finger
IPR015880 432 454 SM00355 Zinc finger
IPR015880 460 482 SM00355 Zinc finger
ProfileScan IPR001909 4 75 PS50805 KRAB box
IPR007087 180 207 PS50157 Zinc finger
IPR007087 208 235 PS50157 Zinc finger
IPR007087 236 263 PS50157 Zinc finger
IPR007087 264 291 PS50157 Zinc finger
IPR007087 292 319 PS50157 Zinc finger
IPR007087 320 347 PS50157 Zinc finger
IPR007087 348 375 PS50157 Zinc finger
IPR007087 376 403 PS50157 Zinc finger
IPR007087 404 431 PS50157 Zinc finger
IPR007087 432 459 PS50157 Zinc finger
IPR007087 460 487 PS50157 Zinc finger
ScanRegExp IPR007087 182 202 PS00028 Zinc finger
IPR007087 210 230 PS00028 Zinc finger
IPR007087 238 258 PS00028 Zinc finger
IPR007087 266 286 PS00028 Zinc finger
IPR007087 294 314 PS00028 Zinc finger
IPR007087 322 342 PS00028 Zinc finger
IPR007087 350 370 PS00028 Zinc finger
IPR007087 378 398 PS00028 Zinc finger
IPR007087 406 426 PS00028 Zinc finger
IPR007087 434 454 PS00028 Zinc finger
IPR007087 462 482 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp