ORK04487

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04487

Order Kazusa clone(s) from :

Accession No	AK226135
Product ID	ORK04487
Clone name	fh19272
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CDK20
cDNA sequence	DNA sequence (5503 bp) Predicted protein sequence (184 aa)
Description	Cell cycle-related kinase (EC 2.7.11.22) (Cyclin-kinase-activating kinase p42) (CDK-activating kinase p42) (CAK-kinase p42) (Cyclin- dependent protein kinase H).

Features of the cloned cDNA sequence

Description

Length: 5503 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	4659 bp
Genome contig ID	gi89161216r_89671391
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TATAATAATAAAGAGTATGATTGTGGTTCAAGGAT
Flanking genome sequence (99790 - 99741)	----+--------+--------+--------+--------+----* AAAAACAGACTAGAGAAACTTATTCTTAGCCATCCTTTATTTTTATTTTA

Features of the protein sequence

Description

Length: 184 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW62748	7.1e-39	98.2	cell cycle rela...	Homo sapiens
XP_001086854	4.3e-37	97.3	similar to cell...	Macaca mulatta
EAW62747	8.9e-34	92.7	cell cycle rela...	Homo sapiens
EAW62745	9.6e-34	92.7	cell cycle rela...	Homo sapiens
EAW62743	1.1e-33	92.7	cell cycle rela...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	61	171	PD000001	Protein kinase
HMMPfam	IPR000719	71	171	PF00069	Protein kinase
ProfileScan	IPR000719	49	184	PS50011	Protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp