ORK04729

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04729

Order Kazusa clone(s) from :

Accession No	AB209382
Product ID	ORK04729
Clone name	fh19555
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DDX24
cDNA sequence	DNA sequence (5511 bp) Predicted protein sequence (676 aa)
Description	ATP-dependent RNA helicase DDX24 (EC 3.6.1.-) (DEAD box protein 24).

Features of the cloned cDNA sequence

Description

Length: 5511 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3479 bp
Genome contig ID	gi51511730r_93487018
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- CTTGATTTCATAAATTAAAAACAATGGTCAGAGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTGTGTCATCCTGATTTTTTTTTTTTTTTTTTAGATAGAAGATGGGGGT

Features of the protein sequence

Description

Length: 676 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92619	100.0	DEAD (Asp-Glu-A...	Homo sapiens
EAW81550	99.8	DEAD (Asp-Glu-A...	Homo sapiens
EAW81552	99.8	DEAD (Asp-Glu-A...	Homo sapiens
Q9GZR7	99.8	ATP-dependent R...	Homo sapiens
XP_001151790	98.7	DEAD (Asp-Glu-A...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	222	522	PF00270	DNA/RNA helicase
HMMPfam	IPR001650	612	668	PF00271	DNA/RNA helicase
HMMSmart	IPR014001	217	547	SM00487	DEAD-like helicases
HMMSmart	IPR001650	607	671	SM00490	DNA/RNA helicase
ProfileScan	IPR014014	198	226	PS51195	RNA helicase
	IPR014021	230	534	PS51192	Helicase
	IPR001650	584	676	PS51194	DNA/RNA helicase
ScanRegExp	IPR000629	475	483	PS00039	RNA helicase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp