ORK04601

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04601

Order Kazusa clone(s) from :

Accession No	AB208844
Product ID	ORK04601
Clone name	fh20327
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	COL11A1
cDNA sequence	DNA sequence (5289 bp) Predicted protein sequence (1017 aa)
Description	Collagen alpha-1(XI) chain precursor.

Features of the cloned cDNA sequence

Description

Length: 5289 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	534 bp
Genome contig ID	gi89161185r_103015629
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGTATTATGAAAAAATAAAGTTGTAATTTCTGATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTCTAAGTCCCTTTCTTTGGTTAATAATAAAATGCCTTTGTATATATTG

Features of the protein sequence

Description

Length: 1017 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92081	100.0	alpha 1 type XI...	Homo sapiens
XP_001139718	99.8	alpha 1 type XI...	Pan troglodytes
AAI17698	100.0	COL11A1 protein...	Homo sapiens
AAF04724	100.0	collagen type X...	Homo sapiens
AAF04725	100.0	collagen type X...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008161	220	242	PD000007	Collagen helix repeat
BlastProDom	IPR000885	907	1016	PD002078	Fibrillar collagen
HMMPfam	IPR008160	94	153	PF01391	Collagen triple helix repeat
	IPR008160	193	252	PF01391	Collagen triple helix repeat
	IPR008160	319	378	PF01391	Collagen triple helix repeat
	IPR008160	430	489	PF01391	Collagen triple helix repeat
	IPR008160	499	558	PF01391	Collagen triple helix repeat
	IPR008160	604	663	PF01391	Collagen triple helix repeat
	IPR008160	673	732	PF01391	Collagen triple helix repeat
	IPR008160	733	753	PF01391	Collagen triple helix repeat
	IPR000885	804	1015	PF01410	Fibrillar collagen
HMMSmart	IPR000885	787	1016	SM00038	Fibrillar collagen

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp