ORK07585

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07585

Order Kazusa clone(s) from :

Accession No	AK226136
Product ID	ORK07585
Clone name	fh20774
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SYT17
cDNA sequence	DNA sequence (5063 bp) Predicted protein sequence (493 aa)
Description	B/K protein

Features of the cloned cDNA sequence

Description

Length: 5063 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	31 bp
Genome contig ID	gi51511732f_18988832
PolyA signal sequence (None)	+--------+--------+----*----+---- CTGAGGGCTGCAGGGAAGGCAGCTTTCATTTGTTT
Flanking genome sequence (197100 - 197149)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGACGGAAAAAAATGTGTCACATACTATTACATCC

Features of the protein sequence

Description

Length: 493 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BSW7	6.4e-190	99.7	Synaptotagmin-1...	Homo sapiens
AAF37825	1.3e-189	99.5	B/K protein [Ho...	Homo sapiens
Q5R8Q5	2.5e-188	98.9	Synaptotagmin-1...	Pongo abelii
XP_001082835	1.5e-187	98.4	similar to B/K ...	Macaca mulatta
XP_536956	2e-187	95.6	similar to B/K ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	242	254	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	269	282	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	293	301	PR00360	C2 calcium-dependent membrane targeting
	IPR001565	344	359	PR00399	Synaptotagmin
	IPR001565	359	372	PR00399	Synaptotagmin
	IPR001565	416	431	PR00399	Synaptotagmin
	IPR001565	436	446	PR00399	Synaptotagmin
HMMPfam	IPR000008	220	313	PF00168	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	357	445	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	219	328	SM00239	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	356	471	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	215	313	PS50004	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	354	445	PS50004	C2 calcium-dependent membrane targeting

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp