ORK06132

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06132

Order Kazusa clone(s) from :

Accession No	AB209412
Product ID	ORK06132
Clone name	fh25863
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NEO1
cDNA sequence	DNA sequence (5895 bp) Predicted protein sequence (1130 aa)
Description	Neogenin precursor.

Features of the cloned cDNA sequence

Description

Length: 5895 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2502 bp
Genome contig ID	gi51511731f_71115379
PolyA signal sequence (AATACA,-18)	+--------+--------+----*----+---- TTTAGTATTGGAAATCCAATACACTTTTTTAATCC
Flanking genome sequence (269215 - 269264)	----+--------+--------+--------+--------+----* AATCAAACTCTGGTCTGGTCAAAGAGTTATTTTCCTTTGTCCTTAAAAAA

Features of the protein sequence

Description

Length: 1130 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92649	100.0	neogenin homolo...	Homo sapiens
XP_001093533	99.2	neogenin homolo...	Macaca mulatta
EDL25960	97.3	neogenin, isofo...	Mus musculus
AAH54540	97.3	Neogenin [Mus m...	Mus musculus
ABG81423	73.7	neogenin varian...	Xenopus borealis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003962	344	353	PR00014	Fibronectin
	IPR003962	359	369	PR00014	Fibronectin
	IPR003962	588	606	PR00014	Fibronectin
	IPR003962	708	722	PR00014	Fibronectin
HMMPfam	IPR013098	17	103	PF07679	Immunoglobulin I-set
	IPR003961	135	221	PF00041	Fibronectin
	IPR003961	235	317	PF00041	Fibronectin
	IPR003961	329	417	PF00041	Fibronectin
	IPR003961	435	514	PF00041	Fibronectin
	IPR003961	533	622	PF00041	Fibronectin
	IPR003961	634	724	PF00041	Fibronectin
	IPR010560	748	1130	PF06583	Neogenin
HMMSmart	IPR003599	23	104	SM00409	Immunoglobulin subtype
	IPR003598	29	93	SM00408	Immunoglobulin subtype 2
	IPR003961	135	218	SM00060	Fibronectin
	IPR003961	235	314	SM00060	Fibronectin
	IPR003961	330	414	SM00060	Fibronectin
	IPR003961	435	514	SM00060	Fibronectin
	IPR003961	534	619	SM00060	Fibronectin
	IPR003961	635	721	SM00060	Fibronectin
ProfileScan	IPR007110	17	102	PS50835	Immunoglobulin-like
	IPR003961	135	228	PS50853	Fibronectin
	IPR003961	235	323	PS50853	Fibronectin
	IPR003961	329	424	PS50853	Fibronectin
	IPR003961	431	523	PS50853	Fibronectin
	IPR003961	533	629	PS50853	Fibronectin
	IPR003961	634	731	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	773	MLLVIIVSVGVITIVVVVIIAVF	795	PRIMARY	23