ORK10413

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10413

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10413
Clone name	fj00447
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	BCL11A
cDNA sequence	DNA sequence (3800 bp) Predicted protein sequence (195 aa)
Description	B-cell lymphoma/leukemia 11A (B-cell CLL/lymphoma 11A)(COUP-TF-interacting protein 1)(Ecotropic viral integration site 9 protein homolog)(EVI-9)

Features of the cloned cDNA sequence

Description

Length: 3800 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3210 bp
Genome contig ID	gi89161199r_60437858
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TCCCTTTATTGAAAAAATAAAAAAAATTAAAGTAC
Flanking genome sequence (99976 - 99927)	----+--------+--------+--------+--------+----* ACATTGTAAGCTTCTTGTGTCCTCATTTGACACACTCTGTAAATTACTTG

Features of the protein sequence

Description

Length: 195 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAX93205	2e-72	100.0	unknown [Homo s...	Homo sapiens
BAC33881	2e-72	99.4	unnamed protein...	Mus musculus
XP_001917590	2.1e-72	100.0	similar to B-ce...	Equus caballus
AAO88272	2.1e-72	100.0	B-cell CLL/lymp...	Homo sapiens
Q9H165	2.2e-72	100.0	B-cell lymphoma...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	104	125	PD000003	Zinc finger
HMMPfam	IPR007087	102	124	PF00096	Zinc finger
	IPR007087	130	152	PF00096	Zinc finger
	IPR007087	160	183	PF00096	Zinc finger
HMMSmart	IPR015880	102	124	SM00355	Zinc finger
	IPR015880	130	152	SM00355	Zinc finger
	IPR015880	160	183	SM00355	Zinc finger
ProfileScan	IPR007087	102	129	PS50157	Zinc finger
	IPR007087	130	152	PS50157	Zinc finger
	IPR007087	160	188	PS50157	Zinc finger
ScanRegExp	IPR007087	104	124	PS00028	Zinc finger
	IPR007087	132	152	PS00028	Zinc finger
	IPR007087	162	183	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp