ORK04672

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04672

Order Kazusa clone(s) from :

Accession No	AK226124
Product ID	ORK04672
Clone name	fj00971
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CTNND2
cDNA sequence	DNA sequence (4113 bp) Predicted protein sequence (1184 aa)
Description	Catenin delta-2 (Delta-catenin) (Neural plakophilin-related ARM-repeat protein) (NPRAP) (Neurojungin) (GT24).

Features of the cloned cDNA sequence

Description

Length: 4113 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	558 bp
Genome contig ID	gi51511721r_10926007
PolyA signal sequence (AAGAAA,-34)	+--------+--------+----*----+---- GAAGAAAAGCGCGTTGTGTATATTACACCAATGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCCGTGTTTCCTCATCTATGGTTCTAAATATTGCTTCAATTTCAAACTTT

Features of the protein sequence

Description

Length: 1184 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UQB3	99.8	Catenin delta-2...	Homo sapiens
XP_001147533	99.6	catenin (cadher...	Pan troglodytes
XP_001147603	99.6	catenin (cadher...	Pan troglodytes
AAC63103	99.4	delta-catenin [...	Homo sapiens
XP_601963	97.5	similar to cate...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000225	498	538	PF00514	Armadillo
	IPR000225	540	580	PF00514	Armadillo
	IPR000225	584	625	PF00514	Armadillo
	IPR000225	793	834	PF00514	Armadillo
	IPR000225	840	880	PF00514	Armadillo
HMMSmart	IPR000225	540	580	SM00185	Armadillo
	IPR000225	584	625	SM00185	Armadillo
	IPR000225	626	683	SM00185	Armadillo
	IPR000225	685	732	SM00185	Armadillo
	IPR000225	793	834	SM00185	Armadillo
	IPR000225	840	880	SM00185	Armadillo
	IPR000225	933	977	SM00185	Armadillo
ProfileScan	IPR000225	551	584	PS50176	Armadillo
	IPR000225	595	638	PS50176	Armadillo
	IPR000225	851	888	PS50176	Armadillo

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp