ORK05871

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05871

Order Kazusa clone(s) from :

Accession No	AB208957
Product ID	ORK05871
Clone name	fj01753
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	LRP12
cDNA sequence	DNA sequence (3805 bp) Predicted protein sequence (793 aa)
Description	Low-density lipoprotein receptor-related protein 12 precursor (Suppressor of tumorigenicity protein 7).

Features of the cloned cDNA sequence

Description

Length: 3805 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1423 bp
Genome contig ID	gi51511724r_105470671
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- TATCAAAAATTAAAATGATTTTTTTTATTGCCTTG
Flanking genome sequence (99983 - 99934)	----+--------+--------+--------+--------+----* AGGTACTTTTTAAATCAAAGCTGTTCTTTATTTGTTGAATTTTGGTGCAT

Features of the protein sequence

Description

Length: 793 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92194	100.0	suppression of ...	Homo sapiens
Q9Y561	99.8	Low-density lip...	Homo sapiens
XP_519901	99.7	suppression of ...	Pan troglodytes
CAH92835	99.4	hypothetical pr...	Pongo abelii
CAH92754	99.3	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002172	110	131	PR00261	Low density lipoprotein-receptor
	IPR002172	164	185	PR00261	Low density lipoprotein-receptor
	IPR002172	320	341	PR00261	Low density lipoprotein-receptor
	IPR002172	358	379	PR00261	Low density lipoprotein-receptor
	IPR002172	395	416	PR00261	Low density lipoprotein-receptor
HMMPfam	IPR000859	3	90	PF00431	CUB
	IPR002172	98	134	PF00057	Low density lipoprotein-receptor
	IPR002172	147	188	PF00057	Low density lipoprotein-receptor
	IPR000859	193	303	PF00431	CUB
	IPR002172	385	419	PF00057	Low density lipoprotein-receptor
HMMSmart	IPR000859	2	93	SM00042	CUB
	IPR002172	101	136	SM00192	Low density lipoprotein-receptor
	IPR002172	148	190	SM00192	Low density lipoprotein-receptor
	IPR000859	193	306	SM00042	CUB
	IPR002172	308	346	SM00192	Low density lipoprotein-receptor
	IPR002172	347	384	SM00192	Low density lipoprotein-receptor
	IPR002172	385	421	SM00192	Low density lipoprotein-receptor
ProfileScan	IPR000859	1	93	PS01180	CUB
	IPR002172	99	135	PS50068	Low density lipoprotein-receptor
	IPR002172	148	189	PS50068	Low density lipoprotein-receptor
	IPR000859	193	306	PS01180	CUB
	IPR002172	308	345	PS50068	Low density lipoprotein-receptor
	IPR002172	346	383	PS50068	Low density lipoprotein-receptor
	IPR002172	384	420	PS50068	Low density lipoprotein-receptor
ScanRegExp	IPR002172	112	134	PS01209	Low density lipoprotein-receptor
ScanRegExp	IPR002172	397	419	PS01209	Low density lipoprotein-receptor

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	423	VPTRVITAAVIGSLICGLLLVIA	445	PRIMARY	23