ORK04623

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04623

Order Kazusa clone(s) from :

Accession No	AB208923
Product ID	ORK04623
Clone name	fj02255
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CRB1
cDNA sequence	DNA sequence (2425 bp) Predicted protein sequence (441 aa)
Description	Crumbs homolog 1 precursor.

Features of the cloned cDNA sequence

Description

Length: 2425 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1037 bp
Genome contig ID	gi89161185f_195404029
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GTAAGCTGCTAGAAATAAATATGAGATCTGCAAAC
Flanking genome sequence (189854 - 189903)	----+--------+--------+--------+--------+----* ATACAGGTCTTTCTGAAATATATTTGTGTATTTACCTCACCTCTGGGGAT

Features of the protein sequence

Description

Length: 441 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92160	2e-204	100.0	crumbs homolog ...	Homo sapiens
AAF01361	5.6e-181	100.0	CRB1 [Homo sapi...	Homo sapiens
BAF82422	5.6e-181	100.0	unnamed protein...	Homo sapiens
P82279	5.6e-181	100.0	Crumbs homolog ...	Homo sapiens
XP_525009	8.7e-181	99.7	crumbs homolog ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001438	211	222	PR00010	EGF-like
	IPR001438	261	268	PR00010	EGF-like
	IPR001438	269	279	PR00010	EGF-like
	IPR001438	319	325	PR00010	EGF-like
HMMPfam	IPR006209	99	132	PF00008	EGF-like
	IPR006209	139	170	PF00008	EGF-like
	IPR006209	177	208	PF00008	EGF-like
	IPR006209	215	246	PF00008	EGF-like
	IPR006209	253	284	PF00008	EGF-like
	IPR006209	291	323	PF00008	EGF-like
	IPR006209	330	361	PF00008	EGF-like
	IPR006209	368	417	PF00008	EGF-like
HMMSmart	IPR006210	58	93	SM00181	EGF
	IPR001881	89	133	SM00179	EGF-like calcium-binding
	IPR006210	98	133	SM00181	EGF
	IPR006210	138	171	SM00181	EGF
	IPR001881	139	171	SM00179	EGF-like calcium-binding
	IPR001881	173	209	SM00179	EGF-like calcium-binding
	IPR006210	176	209	SM00181	EGF
	IPR001881	211	247	SM00179	EGF-like calcium-binding
	IPR006210	214	247	SM00181	EGF
	IPR001881	249	285	SM00179	EGF-like calcium-binding
	IPR006210	252	285	SM00181	EGF
	IPR001881	287	324	SM00179	EGF-like calcium-binding
	IPR006210	290	324	SM00181	EGF
	IPR006210	329	362	SM00181	EGF
	IPR001881	330	362	SM00179	EGF-like calcium-binding
	IPR001881	364	420	SM00179	EGF-like calcium-binding
	IPR006210	367	420	SM00181	EGF
ProfileScan	IPR000742	55	93	PS50026	EGF-like
	IPR000742	95	133	PS50026	EGF-like
	IPR000742	135	171	PS50026	EGF-like
	IPR000742	173	209	PS50026	EGF-like
	IPR000742	211	247	PS50026	EGF-like
	IPR000742	249	285	PS50026	EGF-like
	IPR000742	287	324	PS50026	EGF-like
	IPR000742	326	362	PS50026	EGF-like
	IPR000742	364	420	PS50026	EGF-like
ScanRegExp	IPR013032	121	132	PS00022	EGF-like region
	IPR013032	121	132	PS01186	EGF-like region
	IPR013032	159	170	PS00022	EGF-like region
	IPR013032	159	170	PS01186	EGF-like region
	IPR001881	173	197	PS01187	EGF-like calcium-binding
	IPR000152	188	199	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	197	208	PS00022	EGF-like region
	IPR013032	197	208	PS01186	EGF-like region
	IPR001881	211	235	PS01187	EGF-like calcium-binding
	IPR000152	226	237	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	235	246	PS00022	EGF-like region
	IPR001881	249	273	PS01187	EGF-like calcium-binding
	IPR000152	264	275	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	273	284	PS00022	EGF-like region
	IPR013032	273	284	PS01186	EGF-like region
	IPR001881	287	311	PS01187	EGF-like calcium-binding
	IPR000152	302	313	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR000152	341	352	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	350	361	PS00022	EGF-like region
	IPR013032	350	361	PS01186	EGF-like region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp